SGN Marker CT98

SGN-M555

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT98 image not available
Forward sequence
CTTTTTTTTTTTTTTTCACATCAACTCTATCAAACATGACAGATAATTTTTCATAAATCAAACAATGATGCCCTTAAACACCTGTTTAGG
GGTATTGGACTTTAAACGAAAGAATGTTGCGATTAATATTTCAGGCCCTGGCCTTTTGCTCATCTAGCTTTGTTAGATGAAGCAAAAGAA
GGTGGGGGGAGGAAAAGCTATTTAAGCTGATGTACATTTACTTGTAGCCCCAAGGGC
Reverse sequence
GCCCTTGGGGCTACAAGTAAATGTACATCAGCTTAAATAGCTTTTCCTCCCCCCACCTTCTTCTGCTTCATCTAACAAAGCTAGATGAGC
AAAAGGCCAGGGCCTGAAATATTAATCGCAACATTCTTTCGTTTAAAGTCCAATACCCCTAAACAGGTGTTTAAGGGCATCATTGTTTGA
TTTATGAAAAATTATCTGTCATGTTTGATAGAGTTGATGTGAAAAAAAAAAAAAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39085)
Chromosome
1
Position
35.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9456)
Chromosome
1
Position
26.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT98 was used as an overgo probe on plate 14 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATATTTCAGGCCCTGGCCTTTTG
B sequence
AACAAAGCTAGATGAGCAAAAGGC
AB sequence
AATATTTCAGGCCCTGGCCTTTTGCTCATC
Marker sequence
CTTTTTTTTTTTTTTTCACATCAACTCTATCAAACATGACAGATAATTTT
TCATAAATCAAACAATGATGCCCTTAAACACCTGTTTAGGGGTATTGGAC
TTTAAACGAAAGAATGTTGCGATTAATATTTCAGGCCCTGGCCTTTTGCT
CATCTAGCTTTGTTAGATGAAGCAAAAGAAGGTGGGGGGAGGAAAAGCTA
TTTAAGCTGATGTACATTTACTTGTAGCCCCAAGGGC
Genomic location of CT98  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D555 marker 555
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)