Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker CT229

SGN-M557

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTTTTTGAAATACTAAATAAACCATCTTAAAACGTGTTCACGACGAGTTTTGACTTACAACATACAATAGATTAAT
AATGAAGCTTGCGATTCCCATAACATATAAAGCAGTAGTTATGGCAATATAAGCTCCATAAAAATAAGTTCATAATTGATATGCACTTAC
TTAAGGCATGGGTGGATATATGTTCTCAAACACATAGCTCCATTTTAGAAATCAGAATGCCATCGGTATCTGCATAAAGCCACTCACCAT
CGCAGATTCTAGTCCCGGCAATGGGTTATGGGAACGTGCTTCTCCCCAATACCTTTCTTATTTGCTTTCATTGGATGTGAAGCCAGAGCT
CTGACTCCGATATCACAGCCATTGATTTCGTCCACGTCCCTTACACAGCCATTTACTACGATCCCAGCCCATCCGTTGTTTTGAGCTTGT
ACTACAGGGTTGCCACCCAAAATCGCACATCTTAGACTACCACCCCCGTCTACAACG
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCAAAAAA
AAATTGGGCCTTTTCCCAAAAAAAACCCAAAAATTTTTAGGGGGGGTCCTTTGAACCCAAAAAAAAAGGGCCCCGCCCCCTCCCCCCAAG
GGAACCGAAAACCTCCCCCCGGGGGCCCCCTGGTCCTTTGGGGGGAACCTTTAAAAAAAATTTCCCCATTCCCGGTTCCAAAAAAGCCCC
AAAAAACCCCCCCCCCCCCCCCCGGGTTTTTACCCAGGGGGGCCCTGGCCCCCCCCCCCGAAATTTGCCAAGCCAACCCCCCCCTTTTTG
GGGGGGGGGAACCACGGGGCCCGCCCCCCATCTTTAAAAAAATTGGGGGGGCCCCAATCTTCCCCGGACCCGGTGGCCCCCCAAAAAAAT
TCCAAAAACAAGGTTTGGGCCCGGGATTTCCCCAAGAAAAAAGGCCCCGGAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U145438487 (96.1% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49333)
Chromosome
4
Position
1.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47270)
Chromosome
4
Position
9.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42959)
Chromosome
4
Position
8.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43959
Forward primer (5'-3')
GCTTGCGATTCCCATAACAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GGCTGGGATCGTAGTAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39025)
Chromosome
4
Position
12.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9466)
Chromosome
4
Position
6.60 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9464)
Chromosome
1
Position
18.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9465)
Chromosome
2
Position
82.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT229 was used as an overgo probe on plate 1 [well G10]

Plausible BAC Matches:   P121J22,   P079G02,   P234E22,   P335B17,   P107H12,   P190G05,   P141F08

 Overgo Sequences

A sequence
CCATCGGTATCTGCATAAAGCCAC
B sequence
GAATCTGCGATGGTGAGTGGCTTT
AB sequence
CCATCGGTATCTGCATAAAGCCACTCACCA
Marker sequence
CTTTTTTTTTTTTTTTTTTTGAAATACTAAATAAACCATCTTAAAACGTG
TTCACGACGAGTTTTGACTTACAACATACAATAGATTAATAATGAAGCTT
GCGATTCCCATAACATATAAAGCAGTAGTTATGGCAATATAAGCTCCATA
AAAATAAGTTCATAATTGATATGCACTTACTTAAGGCATGGGTGGATATA
TGTTCTCAAACACATAGCTCCATTTTAGAAATCAGAATGCCATCGGTATC
TGCATAAAGCCACTCACCATCGCAGATTCTAGTCCCGGCAATGGGTTATG
GGAACGTGCTTCTCCCCAATACCTTTCTTATTTGCTTTCATTGGATGTGA
AGCCAGAGCTCTGACTCCGATATCACAGCCATTGATTTCGTCCACGTCCC
TTACACAGCCATTTACTACGATCCCAGCCCATCCGTTGTTTTGAGCTTGT
ACTACAGGGTTGCCACCCAAAATCGCACATCTTAGACTACCACCCCCGTC
TACAACG
Genomic location of CT229  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D557 marker 557
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)