SGN Marker CT99

SGN-M558

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT99 image not available
Forward sequence
CTTTTTTTTTTTTTCTTTCGAGACTTCTCGTGAAGAACTATTTTTTTTTTTTCTATTTCTCGTGACTCTTTTTTAGCGTTTTACTTTTTA
TCACCACACCAAAAGAGTCATATTGAACTCAAATTTTGAACCTACGGAGAGAAGAAAAATTTTGCCCATGGCTCAGCAAATACATGTGGA
AGTTTTATTCCTGTTGGCTTGGTTGGTCACAACTTCATATTCGTATCAATTTACTGGTGGTGGGAAAGATGGTTGGGTCCTTAACCCTTC
TG
Reverse sequence
TTTTTTTTTTTTAAATAAAAATTAAATACATCTATTGTATATCTAAAAACACGCCAATAATCTCCGAATTATTCAAGAAATTAAAAACAA
AATACGGTAAAAAAAAAAGAAAAAACACAAATTAAATATAATATCTAATAATTTTACCCTAAGGTAAAATAATAAATTCTGCCAAAGTCA
CAGTTAAAACGAGTGAAACGGCTGACACAAGTACAACTGATGGAGTAAATGCCTTCACTGCAAATGAATTTGGGTTTTCTGGTGCGCCAG
CTGGCGTATTGATGTCCGCCGGAGTATTGCTGCCGCCGGGACCTAGAGCACTACTTCCCGGTGCTCCCTCCGATGGTCCGCCTGCAAAGG
GTCCTCCTGCAGATGGTCCCGGGGACATACTTACT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1447656.4e-67183 (67.3% of RFLP seq)+
SGN-U1447666.4e-67183 (67.3% of RFLP seq)+
SGN-U1447643.5e-2354 (13.7% of RFLP seq)-
SGN-U1447651.7e-4083 (21.0% of RFLP seq)-
SGN-U1612392.4e-67152 (38.5% of RFLP seq)-
SGN-U1447645e-90178 (45.1% of RFLP seq)-
SGN-U1447654e-146280 (70.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53483)
Chromosome
12
Position
23.92 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51912)
Chromosome
12
Position
59.54 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42367)
Chromosome
10
Position
57.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39086)
Chromosome
12
Position
53.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9471)
Chromosome
12
Position
65.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9473)
Chromosome
10
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9472)
Chromosome
12
Position
40.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9470)
Chromosome
12
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9476)
Chromosome
12
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35571
Forward primer (5'-3')
GTCCCGGTGACATACTTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATTCTGTGTTGGAGGTGAGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 880
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
CT99 was used as an overgo probe on plate 6 [well C6]

Plausible BAC Matches:   P075A23

 Overgo Sequences

A sequence
TACTGGTGGTGGGAAAGATGGTTG
B sequence
AGAAGGGTTAAGGACCCAACCATC
AB sequence
TACTGGTGGTGGGAAAGATGGTTGGGTCCT
Marker sequence
CTTTTTTTTTTTTTCTTTCGAGACTTCTCGTGAAGAACTATTTTTTTTTT
TTCTATTTCTCGTGACTCTTTTTTAGCGTTTTACTTTTTATCACCACACC
AAAAGAGTCATATTGAACTCAAATTTTGAACCTACGGAGAGAAGAAAAAT
TTTGCCCATGGCTCAGCAAATACATGTGGAAGTTTTATTCCTGTTGGCTT
GGTTGGTCACAACTTCATATTCGTATCAATTTACTGGTGGTGGGAAAGAT
GGTTGGGTCCTTAACCCTTCTG
Genomic location of CT99  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D558 marker 558
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)