SGN Marker Hpms1-143

SGN-M5580

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41602)
Chromosome
2
Position
22.00 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43570
Forward primer (5'-3')
AATGCTGAGCTGGCAAGGAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAGGCAGTAGGTGGGGAGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14006)
Chromosome
2
Position
126.42 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34349
Forward primer (5'-3')
AATGCTGAGCTGGCAAGGAAAG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
221
Capsicum frutescens BG2814-6
221
Approximate temperature
Unknown
Reverse primer (5'-3')
TGAAGGCAGTAGGTGGGGAGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-143  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5580 marker 5580
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)