Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker Hpms1-106

SGN-M5581

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14007)
Chromosome
2
Position
127.11 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34651
Forward primer (5'-3')
TCCAAACTACAAGCCTGCCTAACC
Accessions and product sizes
Capsicum annuum NuMex-RNaky
159
Capsicum frutescens BG2814-6
159
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTTGCATTATTGAGTCCCACAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of Hpms1-106  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5581 marker 5581
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)