Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG181

SGN-M559

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
320
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG181 image not available
Forward sequence
ATAGGGAGACAGCTTGCATGCCTGCAGTGGCTGTTGGAAATCTAGCAATCAATGATTATGTTGAAAAGGTGAATACAATTTATAAATTTC
CATTAGTACTTAACAGGCATTATATAAAAGTGAAACTATCAACATCACTTAAGATCTGAAAACGCATTTACCTCATGTGATATGTTATTG
TAGGTCA
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTGGCTGTTGGAAATCTAGCAATCAATGATTATGTTGAAAAGGTGAATACAATTTATAAATTTCCAT
TAGTACTTAACAGGCATTATATAAAAGTGAAACTATCAACATCACTTAAGATCTGAAAACGCATTTACCTCATGTGATATGTTATTGTAG
GTCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9477)
Chromosome
8
Position
36.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG181 was used as an overgo probe on plate 12 [well E10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATAGGGAGACAGCTTGCATGCCTG
B sequence
TTTCCAACAGCCACTGCAGGCATG
AB sequence
ATAGGGAGACAGCTTGCATGCCTGCAGTGG
Marker sequence
ATAGGGAGACAGCTTGCATGCCTGCAGTGGCTGTTGGAAATCTAGCAATC
AATGATTATGTTGAAAAGGTGAATACAATTTATAAATTTCCATTAGTACT
TAACAGGCATTATATAAAAGTGAAACTATCAACATCACTTAAGATCTGAA
AACGCATTTACCTCATGTGATATGTTATTGTAGGTCA
Genomic location of TG181  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D559 marker 559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)