SGN Marker TG286

SGN-M56

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG286 image not available
Forward sequence
TGACTCGCAGCCTTGAAAACTGCTCATGCTCCCAGGCTACCTACATTATTTTAGTAGCTTTAGCACAGAAACTATTACACATGGCCTTCT
AAGGAAATAAGACAAGTCAAAATGGCAGGAGCAACTGATATTCAACTACAAAACCAAGCTCAATAACTTAGTGCTCAATCAGTGTTAATA
CTATTCAATATAGCTACAAATGAGCTGGGAAAATCTCAACCCTACCCCAACATAAGATCAGATGGAAAGCTTCCTCCTTCACAAGAGAGA
ATGCTAAATAGAAGTTTGAATAAACAGTTCCTGGGGGGATAGCAGCCAAGGAGAAGATGTTTGAAGGAGAAAAAGAATACTCAGATGCCA
GAACATTGAGATTGTCACTAAATCACCAGTTTAATATAACTGACTACTAAAACCCAAAACCAGAAAACACTCTATGGTTATAACCAGACA
GATTC
Reverse sequence
CATTGTCAGTTGGAAGTGATAGCAATGGAAGTGGTGTTGTGGCACTTCTTGAGATAGCTAGGCTGTTTTCTGTTCTGTATTCAAATCCTA
AAACAAGGGGTAGATATAACTTACTTTTTGGATTGACGTCTGGTGGGCCTTATAACTTCAACGGAACTCAGAAGGTGCACTACTCCTTCC
TGAGCATTTTCTATGCATAAGTTGCAGTATATCTTGCTGTGTCTTTTCAATCTGTAGTTTCTTTCTCTTCAGTGGCTTCGAAGTTTTGAC
CAACGCCTACGGGAGAGTATCGACTATGCCATTTGCTTGAATAGTCTTGGCTCCTTGGGCAATGAGTTACATCTTCATGTTTCTAAACCT
CCTGAAAACACATACATACAACAAATATTTCAGGTATGGATTATTGCATCAACTGAAAGAATCTTGGAGTATTTCAATTTTTGTTACTTC
TACCACAATCCTTTCTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1561493.2e-0540 (8.8% of RFLP seq)+
SGN-U1471089e-1540 (8.8% of RFLP seq)+
SGN-U1561493.3e-0544 (9.4% of RFLP seq)-
SGN-U1561493.7e-1459 (12.6% of RFLP seq)-
SGN-U1471088.1e-77144 (30.8% of RFLP seq)-
SGN-U1471089.4e-89164 (35.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 7891)
Chromosome
11
Position
48.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7892)
Chromosome
11
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG286 was used as an overgo probe on plate 11 [well C4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P219N22,   P118P14,   P303G16,   P246O23,   P315O19

 Overgo Sequences

A sequence
CAGCCTTGAAAACTGCTCATGCTC
B sequence
AATGTAGGTAGCCTGGGAGCATGA
AB sequence
CAGCCTTGAAAACTGCTCATGCTCCCAGGC
Marker sequence
TGACTCGCAGCCTTGAAAACTGCTCATGCTCCCAGGCTACCTACATTATT
TTAGTAGCTTTAGCACAGAAACTATTACACATGGCCTTCTAAGGAAATAA
GACAAGTCAAAATGGCAGGAGCAACTGATATTCAACTACAAAACCAAGCT
CAATAACTTAGTGCTCAATCAGTGTTAATACTATTCAATATAGCTACAAA
TGAGCTGGGAAAATCTCAACCCTACCCCAACATAAGATCAGATGGAAAGC
TTCCTCCTTCACAAGAGAGAATGCTAAATAGAAGTTTGAATAAACAGTTC
CTGGGGGGATAGCAGCCAAGGAGAAGATGTTTGAAGGAGAAAAAGAATAC
TCAGATGCCAGAACATTGAGATTGTCACTAAATCACCAGTTTAATATAAC
TGACTACTAAAACCCAAAACCAGAAAACACTCTATGGTTATAACCAGACA
GATTC
Genomic location of TG286  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D56 marker 56
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)