SGN Marker TG329

SGN-M560

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGCCAGTGTCACTTTTATTTTGCTTTCACTTTTTGATTCATGACCATTAAATCTCTCTTTATCCTGTCCGATAAAAGGATAATCGGAAAC
AGAAAATCTACCTTTGCTTTTCTATTTTTCTAATAATAAAAAAAATTCAATCACTTTTCTTTGATTTTATTATAGAAGGCAAAGAAGAAA
AATTCCAAAAAAATTTATAAGTAAGAGAAGAAGTCGCATTATTGTTGTGATGTGAGAGCTATCGGCTATTGAAAAGAACTTTATGATTTG
GATAAACTATAAGTTATGTCCAAATCAATGTTATGTTCCTATCTTTAATTTCCTTTGCTTCTTAAAATATACTTAAAAAAGTCAATTCGT
GCAATACTTGTATAACATGGACACGAAATTATGTGCCAGTATTTTTTTATATACGCCAATCTATACAGCTAACGTTTATTTCTTATCTTC
CTTTCCCTTTTAAGTTGTAAAGTTTGTAACTGACGTAACATATTGATACAGCTAAATAAGT
Reverse sequence
CTCACTATAGGGAGACAAGCCTGCATGCCTACAGAGCCAGTGTCACTTTTACTTTGCTTTCACTTTTTGATTCATGACCATTAAATCTCT
CTTTATCCTGTCCGATAAAAGGATAATCGGAAACAGAAAATCTACCTTTGCTTTTCTATTTTTCTAATAATAAAAAAAATTCAATCACTT
TTCTTTGATTTTATTATAGAAGGCAAAGAAGAAAAATTCCAAAAAAATTTATAAGTAAGAGAAGAAGTCGCATTATTGTTGTGATGTGAG
AGCTATCGGCTATTGAAAAGAACTTTATGATTTGGATAAACTATAAGTTATGTCCAAATCAATGTTATGTTCCTATCTTTAATTTCCTTT
GCTTCTTAAAATATACTTAAAAAAGTCAATTCGTGCAATACTTGTATAACATGGACACGAAATTATGTGCCAGTATTTTTTTATATACGC
CAATCTATACAGCTAACGTTTATTTCTTATCTTCCTTTCCCTTTTAAGTTGTAAAGTTTGTAACTGACGTAACATATTGATACAGCTAAA
TAAGTTACTAGAGAAGTAAAATAATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50371)
Chromosome
7
Position
54.34 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48305)
Chromosome
7
Position
34.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39998)
Chromosome
7
Position
31.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9478)
Chromosome
7
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG329 was used as an overgo probe on plate 9 [well G2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAGAAGTCGCATTATTGTTGTG
B sequence
CCGATAGCTCTCACATCACAACAA
AB sequence
AGAAGAAGTCGCATTATTGTTGTGATGTGA
Marker sequence
AGCCAGTGTCACTTTTATTTTGCTTTCACTTTTTGATTCATGACCATTAA
ATCTCTCTTTATCCTGTCCGATAAAAGGATAATCGGAAACAGAAAATCTA
CCTTTGCTTTTCTATTTTTCTAATAATAAAAAAAATTCAATCACTTTTCT
TTGATTTTATTATAGAAGGCAAAGAAGAAAAATTCCAAAAAAATTTATAA
GTAAGAGAAGAAGTCGCATTATTGTTGTGATGTGAGAGCTATCGGCTATT
GAAAAGAACTTTATGATTTGGATAAACTATAAGTTATGTCCAAATCAATG
TTATGTTCCTATCTTTAATTTCCTTTGCTTCTTAAAATATACTTAAAAAA
GTCAATTCGTGCAATACTTGTATAACATGGACACGAAATTATGTGCCAGT
ATTTTTTTATATACGCCAATCTATACAGCTAACGTTTATTTCTTATCTTC
CTTTCCCTTTTAAGTTGTAAAGTTTGTAACTGACGTAACATATTGATACA
GCTAAATAAGT
Genomic location of TG329  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D560 marker 560
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)