SGN Marker TG186

SGN-M561

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1770
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG186 image not available
Forward sequence
CTTCACCGGTCGTCGGCGATGAGGATTCTCAGTCCCCGACGGCGTATGAGATTCTTCAGGAATACGACTTTCCGGTAGGGATACTTCCGA
AGGGCGTAACAAGGTACGAACTCGACAAAACAACGGGCAATTTCGCCGTTTACTTTAACAAATCGTGCAGTTTCAGCATAAGCGGCTATA
ATCTCAAGTATATGAGTAAAATTACTGGTAAAATCTCTAAGGATCGACTTGCGAACTTGAAAGGCGTACAGGTGAAACTGCTTTTGTTTT
GGATTAATATCGTCGAAGTTACTCGTGACGGCGACGATCTCGATTTCTCCGTCGGTATTGCTTCTGCTGATTTTGCAATTGATAACTTCT
ATGAATCGCCACAGTGTGGATGTGGATTTGATTGTGTCAATTCTGGAGAAAACGGCACAGGTAAGTTCGATTTGGAGCTGCTTATCACTT
CGTCTTGAATCGTTAACTGAAATTTTTCAGAAATCGACTGTAAATTAAGATGTTTTAGGATGAAA
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGCGGCGGTGACTAACGGCGGTAGAGTTGTAAGGAAGAGGATTAAGAGAGGAAAAGCGA
GGGTAACGGCGATCTGACGTGGAGAAAACATTGAGGCTACCGTTTTCTTGTGATGATTTTCGTATCAATTGGATATTCAGATGCGATTAC
TCCGATGATGCGCCGACGATATGTATAATTGACTTTGGGGAAGTTTCAATTATTGCAGAAGATGACAGAAAAAAATTAGTTCGACGTTGG
TATCTTGCATTGCATAATATTTATGCCCACCGGTCCCGTTTTATATGGTTGATTTGATGCAATATTTAAGAACTGATTTTTTTTTTTTAT
TTCTTTGATCTACATCTTTATTGAAGTATAAATATAAAAATTATTTCATCAATAATAAACAGAAATTAAAATTATTTTTTTCTAATTGTA
AACTTTTTTTTTGGCATATATGATTTAATTTTGAATATCAAGTTATTAATATTTCAAAAATATAACAAAAAATATATACATATTATTAAA
ATAATCTCAAATATATTTGTTTTTTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1636827e-167415 (80.6% of RFLP seq)+
SGN-U163683511 (99.2% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53876)
Chromosome
9
Position
41.70 cM
Confidence
uncalculated
Protocol
RFLP

Color_a_a9_1Dry_matter_weight_dmw9_1Soluble_solid_content_ssc9_1Titratable_acidity_ta9_1 Color_b_b9_1 Color_L_L9_1Elasticity_ela9_1 3_Methylthio_propanal_content_mta9_1 3_Methylthio_propanal_content_mta9_2 2_Methylbut_2_enal_content_bea9_1 Orthomethoxy_phenol_content_myp9_1 Eugenol_content_eug9_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39933)
Chromosome
9
Position
61.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9480)
Chromosome
9
Position
66.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG186 was used as an overgo probe on plate 15 [well C6]

Plausible BAC Matches:   P248I10,   P172C10,   P124C22

 Overgo Sequences

A sequence
AAGGGCGTAACAAGGTACGAACTC
B sequence
TGCCCGTTGTTTTGTCGAGTTCGT
AB sequence
AAGGGCGTAACAAGGTACGAACTCGACAAA
Marker sequence
CTTCACCGGTCGTCGGCGATGAGGATTCTCAGTCCCCGACGGCGTATGAG
ATTCTTCAGGAATACGACTTTCCGGTAGGGATACTTCCGAAGGGCGTAAC
AAGGTACGAACTCGACAAAACAACGGGCAATTTCGCCGTTTACTTTAACA
AATCGTGCAGTTTCAGCATAAGCGGCTATAATCTCAAGTATATGAGTAAA
ATTACTGGTAAAATCTCTAAGGATCGACTTGCGAACTTGAAAGGCGTACA
GGTGAAACTGCTTTTGTTTTGGATTAATATCGTCGAAGTTACTCGTGACG
GCGACGATCTCGATTTCTCCGTCGGTATTGCTTCTGCTGATTTTGCAATT
GATAACTTCTATGAATCGCCACAGTGTGGATGTGGATTTGATTGTGTCAA
TTCTGGAGAAAACGGCACAGGTAAGTTCGATTTGGAGCTGCTTATCACTT
CGTCTTGAATCGTTAACTGAAATTTTTCAGAAATCGACTGTAAATTAAGA
TGTTTTAGGATGAAA
Genomic location of TG186  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D561 marker 561
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)