SGN Marker Hpms1-173

SGN-M5635

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14064)
Chromosome
3
Position
72.63 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34393
Forward primer (5'-3')
TGCTGGGAAAGATCTCAAAAGG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
163
Capsicum frutescens BG2814-6
163
Approximate temperature
Unknown
Reverse primer (5'-3')
ATCAAGGAAGCAAACCAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-173  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5635 marker 5635
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)