SGN Marker BM61910

SGN-M5645

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14076)
Chromosome
3
Position
104.02 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34514
Forward primer (5'-3')
ATTGTGATAGCAACCCCTGG
Accessions and product sizes
Capsicum frutescens BG2814-6
292
Capsicum annuum NuMex-RNaky
292
Approximate temperature
Unknown
Reverse primer (5'-3')
CACAGATGAGGGCACAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of BM61910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5645 marker 5645
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)