SGN Marker TG400

SGN-M565

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTCAATAGAGGATGCTATACAGGCTAACAGTTATCATCCTAATGCGGAAAGGCGTCTGAATATGGGTGATGTTGAACAGTGTTTTC
AATCAGGTCAATGTGACCATATTATAGAAGGAGAAGTTAGGGTAGGTGGTCAGGAACATTTTTATTTGGAGCCTCAGGGCACTTTAATAT
GGACAGTGGATAGTGGGAATGAGGTGCACATGCTCTCATCTACCCAGGTACTTCAACAGAAATCTAGTCATTTTCTCATGTTTTGTCAAG
TATATTTTGGTTTATAAGACATCAATTGAGGTGTTGGGTTCTTTGTTTGTCTTTTTTCCCAATAAAACCTGTTGCTTGCTTGGATATATG
TAATTTTTGATTATCCCTTTAAAAAGATGGTAATAAGTGTAATGGCTATCCATTGGCCATTGAATTGACAGCCGTTTCTTCTCCATAAAG
CTTCAATCCTGATATGGAAGTCATTTTAGTTAATAAATTGCTCATAT
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGCAGCAAGGAAAGCAGATCTACTCTCCTTGCCTCCAAATCCACCACCTATCCTTTTAG
TCTTGCAAACCACTTTTGACATCGGAAGACCAAGAACGTGAGAAACATACTCCTGGTGCTTCTGAGGAGCCTGCAAAATAGACAATGATC
CTCTTACAAAATTTTCAGCAGAGATATTAAATTACAGGGATGTAGCATTTTAAGCTGGTTTCACCCTAATTCATATGTCGAACCAAACCA
GGCTTACAGCATAATAATGATCTGTAAAATTCTAAACAACCTTGCGGAACTAGCTAATTGAAGTCAAAGAGCACACTCATGACTAATTCT
AATCTGACAATGCCAAACTTAGATAATTATAATTGATCAGACATATATATATCATGTGAGTGTGAGAAATCCAGAGCAAAATCATGAACT
TTAGCAGGGAGCAATGCTATCTATAGTTAAAGATAGGTTTTGCATGATTTTTTACTGTGTAAAAAAGTAAAGAGTAGCAGTACAGAATAA
GCATTTTAAAATGCATAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1445481.1e-60161 (32.4% of RFLP seq)+
SGN-U1445486.7e-47134 (24.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53549)
Chromosome
11
Position
85.72 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53297)
Chromosome
11
Position
47.25 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42456)
Chromosome
12
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40029)
Chromosome
11
Position
57.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9485)
Chromosome
11
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9487)
Chromosome
12
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9486)
Chromosome
11
Position
48.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 141
Forward primer (5'-3')
TCCAAATCCACCACCTATCC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 104+300
Solanum pennellii LA716: 404
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATTGCTCCCTGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 404
Solanum pennellii LA716: 404
Approximate temperature
55°C
  
PCR data   Exp. ID 141
Forward primer (5'-3')
TCCAAATCCACCACCTATCC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 404
Solanum lycopersicum LA925: 104+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATTGCTCCCTGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 404
Solanum lycopersicum LA925: 404
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG400 was used as an overgo probe on plate 1 [well F6]

Plausible BAC Matches:   P107N23,   P277A04,   P206H21,   P172G16,   P256E01

 Overgo Sequences

A sequence
TGGACAGTGGATAGTGGGAATGAG
B sequence
ATGAGAGCATGTGCACCTCATTCC
AB sequence
TGGACAGTGGATAGTGGGAATGAGGTGCAC
Marker sequence
TTTTTTCAATAGAGGATGCTATACAGGCTAACAGTTATCATCCTAATGCG
GAAAGGCGTCTGAATATGGGTGATGTTGAACAGTGTTTTCAATCAGGTCA
ATGTGACCATATTATAGAAGGAGAAGTTAGGGTAGGTGGTCAGGAACATT
TTTATTTGGAGCCTCAGGGCACTTTAATATGGACAGTGGATAGTGGGAAT
GAGGTGCACATGCTCTCATCTACCCAGGTACTTCAACAGAAATCTAGTCA
TTTTCTCATGTTTTGTCAAGTATATTTTGGTTTATAAGACATCAATTGAG
GTGTTGGGTTCTTTGTTTGTCTTTTTTCCCAATAAAACCTGTTGCTTGCT
TGGATATATGTAATTTTTGATTATCCCTTTAAAAAGATGGTAATAAGTGT
AATGGCTATCCATTGGCCATTGAATTGACAGCCGTTTCTTCTCCATAAAG
CTTCAATCCTGATATGGAAGTCATTTTAGTTAATAAATTGCTCATAT
Genomic location of TG400  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D565 marker 565
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)