SGN Marker AA840689

SGN-M5651

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14082)
Chromosome
3
Position
132.77 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34624
Forward primer (5'-3')
GACAACATAGGCGGACCTTTGG
Accessions and product sizes
Capsicum frutescens BG2814-6
267
Capsicum annuum NuMex-RNaky
267
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCTTTAGGTCTACGTCCTTGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Byung-Dong Kim
Organization: Seoul National University
Genomic location of AA840689  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5651 marker 5651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)