SGN Marker BM62655

SGN-M5652

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41280)
Chromosome
3
Position
140.10 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43257
Forward primer (5'-3')
AGGAACGGCAGTCTTGCTAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATGCTAGGTCTGGATTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14083)
Chromosome
3
Position
143.39 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34524
Forward primer (5'-3')
AGGAACGGCAGTCTTGCTAG
Accessions and product sizes
Capsicum frutescens BG2814-6
255
Capsicum annuum NuMex-RNaky
255
Approximate temperature
Unknown
Reverse primer (5'-3')
GATGCTAGGTCTGGATTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of BM62655  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5652 marker 5652
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)