SGN Marker CA523715

SGN-M5656

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41559)
Chromosome
4
Position
147.30 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43535
Forward primer (5'-3')
CATCATTTCTCCCCAATTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GTGGTGGGTGGGGTAAAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14088)
Chromosome
4
Position
6.79 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34523
Forward primer (5'-3')
CATCATTTCTCCCCAATTCC
Accessions and product sizes
Capsicum frutescens BG2814-6
202
Capsicum annuum NuMex-RNaky
202
Approximate temperature
Unknown
Reverse primer (5'-3')
GTGGTGGGTGGGGTAAAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of CA523715  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5656 marker 5656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)