SGN Marker CT231

SGN-M566

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT231 image not available
Forward sequence
CTTTTTTTTTTTCAAAACTAAAAATTGGCATTCATCGCAGAATAAACTACAAGGGTTTTCACTAGAGTGATTTATACATTTTCTGTATGG
AACTGTATTGGCTACAGAAGAGCAAGGGACGAGATAAATATAATCCCCAAACACCACATTACCTTTGGTTCCTCCTCCTATCTCATCCTT
ACTATAGCTACCTCTAGCTGCATTATAGGCTGTGAGGTTCTTGACACATGAAACGTGCCAGAATCAGTTACGCCAACTGTTTAACTTCTT
TGCTTCAAAGGAGGCACCATCATTGAGCATGTCTTGTGCATCAGTTTCCATACCAAGCTTGGATAGGGCAAGAGCCTGCATATAAAATGC
AGTAGGCCACTCGGGCAAGCACACCTGGGCTTGCGTAGCGTCCCTTACTGCGAGTTCTGGTTGGCCATTCATCATGTAGGAAAGGGCTCG
CCTCACGAAAACAGTGCCAGAAGGAACAGACATCATTGATACTAACT
Reverse sequence
TTTTTGATGAGGAAGGTGACCCTCGATTGTCTAGTTTTGGTCTAATGAAAAATAGCAGAGATGGAAAGAGCTATAGCACCAATCTTGCTT
ATACACCTCCTGAGTTTTTGCGCACAGGCCGAGTAATCGCAGAAAGTGTGATGTACAGCTATGGGACTGTTCTGCTGGACCTGTTGAGTG
GAAAACATATCCCACCAAGCCATGCACTAGACTTAATTAGGGGTAAAAATGTATTGTTATTAATGGATTCATCCTTGGAAGGACAATATG
CCAATGAAGATGCAACAGCATTGGTTGAACTTGCTTCAAAGTGTCTCCAATATGAGGCAAGGGATCGACCTGAAATTAAGTTCATTCTAA
ATGCAGTGGAGCCCCTTCAAAAGCAGAAGGAGGCCGCGTCACATGTCCTGATGGGTCTAACAAAAACTCCAGTGGTGCTTCCAACCATGC
TCTCACCTCTAGGAAAGGCTTGTGCGAGGATGGACCTCACTGCTGTCCATGATATCTTGCTCAAAACAGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146929485 (97.6% of RFLP seq)+
SGN-U1527232.5e-1272 (13.8% of RFLP seq)-
SGN-U146929520 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49334)
Chromosome
1
Position
72.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47271)
Chromosome
1
Position
49.18 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42332)
Chromosome
1
Position
84.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39026)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9491)
Chromosome
1
Position
59.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9493)
Chromosome
1
Position
100.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9492)
Chromosome
1
Position
35.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT231 was used as an overgo probe on plate 5 [well H10]

Plausible BAC Matches:   P009B14,   P017D14,   P030O17,   P222H15,   P065C09,   P015L13,   P039M19,   P047J01

 Overgo Sequences

A sequence
GCATTATAGGCTGTGAGGTTCTTG
B sequence
GGCACGTTTCATGTGTCAAGAACC
AB sequence
GCATTATAGGCTGTGAGGTTCTTGACACAT
Marker sequence
CTTTTTTTTTTTCAAAACTAAAAATTGGCATTCATCGCAGAATAAACTAC
AAGGGTTTTCACTAGAGTGATTTATACATTTTCTGTATGGAACTGTATTG
GCTACAGAAGAGCAAGGGACGAGATAAATATAATNNNNAAACACCACATT
ACCTTTGGTTCCTCCTCCTATCTCATCCTTACTATAGCTACCTCTAGCTG
CATTATAGGCTGTGAGGTTCTTGACACATGAAACGTGCCAGAATCAGTTA
CGCCAACTGTTTAACTTCTTTGCTTCAAAGGAGGCACCATCATTGAGCAT
GTCTTGTGCATCAGTTTCCATACCAAGCTTGGATAGGGCAAGAGCCTGCA
TATAAAATGCAGTAGGCCACTCGGGCAAGCACACCTGGGCTTGCGTAGCG
TCCCTTACTGCGAGTTCTGGTTGGCCATTCATCATGTAGGAAAGGGCTCG
CCTCACGAAAACAGTGCCAGAAGGAACAGACATCATTGATACTAACT
Genomic location of CT231  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D566 marker 566
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)