SGN Marker CAN130829

SGN-M5668

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41563)
Chromosome
4
Position
100.00 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43539
Forward primer (5'-3')
GCTAATTACTTGCTCCGTTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATGGGGGAGTTTGTTTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14102)
Chromosome
4
Position
53.65 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34570
Forward primer (5'-3')
GCTAATTACTTGCTCCGTTTTG
Accessions and product sizes
Capsicum frutescens BG2814-6
184
Capsicum annuum NuMex-RNaky
184
Approximate temperature
Unknown
Reverse primer (5'-3')
AATGGGGGAGTTTGTTTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Byung-Dong Kim
Organization: Seoul National University
Genomic location of CAN130829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5668 marker 5668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)