SGN Marker TG401

SGN-M568

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG401 image not available
Forward sequence
GATGTTGTTCTAGTCCAGTTGCAGAGACTATGCAACATACTTCATCTTTTAAAAAGCTGTACAACTGAAAGATGATAATGATGAAATTTT
TATTGCCTTCTCATTGCTTACACAATGTGGCAACACTTAGATGTAGAAACTATGTAAGGTATGCCACATCTGTATATCTCTGAACTACAG
AGACTTTACCCTTGAGATAGTTTCCCGATGATCAATAACAATAAATGCTATAGCTATAAGCTAAAATGGACCATTGAAAAGATACACAGC
TAACGAAACTTGGTGATGTCACTATAGGACACTGTTATAGAGAGGCCAATAAGGTTGCAGACTATCTTATCAAACTAACCTCGGTCAGTC
ATAATGAGTGTTTTTATGACTCCTATAATTTTCTTCTTGTGATAGCTAGATGCCACTCCAATTGGATAAACTGAGACCTTGT
Reverse sequence
GCATGCCTGCAGTATGGACTCACAAGGACGAGACAGAAATGCCGGTGAAGGAATTGTTATCGGTTTTATTGATTCTGGGATTGACCCAGA
CCACCCTAGCTTCGCGTATGATCCCACGACAAATAAAACTTTTACTGGTAGCTTTTCTGGAGCTTGTGAGGAAGGTCCTTTATTTCCCCA
AACTTCCTGCAATGGTAAAATAGTATCTGCCAGGTTTTTCTCAGCTGGAGCGCAAACTACTACCACACTAAATGACTCCATGGATATATT
ATCACCCTTTGATGCTGTTGGACATGGCAGGTAAAATGCATATTGACTTGTATTTGGTATCTATTAACCTGTGTTCTAGAATGAAAATGT
GACCTGTATTTTCCTTTACAGTCATGTAGCTTCAACTGCAACTGGAAATTTTGGAGTTCCAGTAGTGGTAAATGGATTGTATTATGGACG
AGCAAGTGGAATGGCACCGCGGGCGAGGTAATTTCATACACATACATATAGGCACAATGAAAAAGGATGGTTTCTAAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40030)
Chromosome
3
Position
75.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9499)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG401 was used as an overgo probe on plate 5 [well E5]

Plausible BAC Matches:   P255E21,   P324A01,   P245A24,   P055K17,   P059H03,   P002H14,   P150M08,   P257C01,   P075G19,   P039M01,   P283O15,   P299H10,   P145L15,   P292L24,   P316H13,   P255F21,   P252F22,   P092L12,   P068C06,   P231I22,   P160K01,   P324G09,   P299I10

 Overgo Sequences

A sequence
CTCTGAACTACAGAGACTTTACCC
B sequence
CGGGAAACTATCTCAAGGGTAAAG
AB sequence
CTCTGAACTACAGAGACTTTACCCTTGAGA
Marker sequence
GATGTTGTTCTAGTCCAGTTGCAGAGACTATGCAACATACTTCATCTTTT
AAAAAGCTGTACAACTGAAAGATGATAATGATGAAATTTTTATTGCCTTC
TCATTGCTTACACAATGTGGCAACACTTAGATGTAGAAACTATGTAAGGT
ATGCCACATCTGTATATCTCTGAACTACAGAGACTTTACCCTTGAGATAG
TTTCCCGATGATCAATAACAATAAATGCTATAGCTATAAGCTAAAATGGA
CCATTGAAAAGATACACAGCTAACGAAACTTGGTGATGTCACTATAGGAC
ACTGTTATAGAGAGGCCAATAAGGTTGCAGACTATCTTATCAAACTAACC
TCGGTCAGTCATAATGAGTGTTTTTATGACTCCTATAATTTTCTTCTTGT
GATAGCTAGATGCCACTCCAATTGGATAAACTGAGACCTTGT
Genomic location of TG401  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D568 marker 568
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)