SGN Marker GPMS203

SGN-M5685

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41598)
Chromosome
4
Position
65.10 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43566
Forward primer (5'-3')
CACCAACACATCTTTTTCAACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATAATAGTGGTTGCGGCGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14121)
Chromosome
4
Position
81.80 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3
Genomic location of GPMS203  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5685 marker 5685
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)