SGN Marker Hpms1-165

SGN-M5698

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41603)
Chromosome
4
Position
58.20 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43571
Forward primer (5'-3')
GGCTATTTCCGACAAACCCTCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCATTGGTGTTTTCACTGTTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14134)
Chromosome
4
Position
86.71 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34548
Forward primer (5'-3')
GGCTATTTCCGACAAACCCTCAG
Accessions and product sizes
Capsicum frutescens BG2814-6
213
Capsicum annuum NuMex-RNaky
213
Approximate temperature
Unknown
Reverse primer (5'-3')
CCATTGGTGTTTTCACTGTTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-165  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5698 marker 5698
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)