SGN Marker TG645

SGN-M57

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG645 image not available
Forward sequence
AATGATGCAATTTTCTTAATGCTACCCACATCCCTAAAAGCTAAAAAAACTTTTCTTTGATTTTTCTTGATATTTACAATGCTAACATAT
TCTTGAAAAATTCGATTTCTTTAATTCCTCAACATATGAACAATGTAGTAACTTCAAAAAGAAACCAATTTCTTGATTTTTTTCTTAAAT
CAAGAATTCCAAGTTCAGGAATTTACCAAGATAAGAGTAGCGAATCTTGGCAGTAGGTATTATCGCCGTCACTGGAAAGTTAAGCGCTGG
TATTGAATAGTTTTGATCGTACATCGTCACCGGAGTGTTAAGGGCCGGTAGCGTACAACTTCAGCAGAGTAGCGTATGAAGTTCCCCGGT
CTTCTGTAATTTGAAATAAGGAGAAGATAGTACGTGTATTTATACACGCGGAAAAATCTCAACTCTTTTTAAAATATAAATCAACTTTTT
TTAATAATACATTATT
Reverse sequence
CATCTTAGTTTGTCACACATATATATATACACACAACGAGTATACAGTCACTTCATCCACCTGTGCAGGAACCAAACCATGAGGATCCCC
TTAATCTCGAGGCTGCTTCTGTGTTGAGAGATAATCCCCAGTTGTTTAAATCAAATGTGAAGAAGGCTATGCTTGGTGGAACTGTGGCCA
ATGTAAGCTTCACGCGGTGCCTGTAGCCTGTCCTCTGATGCTGGCAATAAGTGTTTCCGATCAGATGCTGTATCATATGGTGTCTGCAAA
CTTGCAATGCCTTCATTTTTATGGAGTATATAAATTTTAGCGAATATTTATTTTGTATAAATATCATCAATTAGGTATTTGGAAAATATT
GATCTCCTTTATTTTCTCTTTCTTGGGGTCTGCTTCTTGTTTGAATGATAAAAGAAATTATACACATCTTGGTTGAAACCGATATCAATG
AAGTGTGCAGGTTGCTTCGGAGACTACTGTCATTCAGATACAGAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1575878.3e-80149 (32.0% of RFLP seq)+
SGN-U1723243.2e-36189 (38.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53580)
Chromosome
2
Position
67.86 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43886)
Chromosome
2
Position
24.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43626)
Chromosome
2
Position
67.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43349)
Chromosome
2
Position
77.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7893)
Chromosome
2
Position
74.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG645 was used as an overgo probe on plate 7 [well A2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P053L21,   P266M22,   P020B05

 Overgo Sequences

A sequence
GAGTAGCGAATCTTGGCAGTAGGT
B sequence
CAGTGACGGCGATAATACCTACTG
AB sequence
GAGTAGCGAATCTTGGCAGTAGGTATTATC
Marker sequence
AATGATGCAATTTTCTTAATGCTACCCACATCCCTAAAAGCTAAAAAAAC
TTTTCTTTGATTTTTCTTGATATTTACAATGCTAACATATTCTTGAAAAA
TTCGATTTCTTTAATTCCTCAACATATGAACAATGTAGTAACTTCAAAAA
GAAACCAATTTCTTGATTTTTTTCTTAAATCAAGAATTCCAAGTTCAGGA
ATTTACCAAGATAAGAGTAGCGAATCTTGGCAGTAGGTATTATCGCCGTC
ACTGGAAAGTTAAGCGCTGGTATTGAATAGTTTTGATCGTACATCGTCAC
CGGAGTGTTAAGGGCCGGTAGCGTACAACTTCAGCAGAGTAGCGTATGAA
GTTCCCCGGTCTTCTGTAATTTGAAATAAGGAGAAGATAGTACGTGTATT
TATACACGCGGAAAAATCTCAACTCTTTTTAAAATATAAATCAACTTTTT
TTAATAATACATTATT
Genomic location of TG645  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D57 marker 57
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)