Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker Hpms1-69

SGN-M5700

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14136)
Chromosome
4
Position
87.87 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34550
Forward primer (5'-3')
CGGTGGCATGTAGTTTCTGGAG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
217
Capsicum frutescens BG2814-6
217
Approximate temperature
Unknown
Reverse primer (5'-3')
AAGACATGAAATCCACAAGTTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-69  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5700 marker 5700
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)