Notice: The contact form functionality has been restored. Apologies for any inconvenience.

SGN Marker asu2

SGN-M5701

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14137)
Chromosome
4
Position
89.05 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34373
Forward primer (5'-3')
GGGTCTATCGGAAACAACCTTTCTAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CTCTATGAATGGTGGGCCAGTAGTACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Umesh Reddy
Organization: Alcorn State University
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of asu2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5701 marker 5701
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)