SGN Marker CT235

SGN-M571

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT235 image not available
Forward sequence
ATTTAACTCATTTTCTTCTTCTCAATTCATGACTTCTTCGTTTAGCGATCTTCTTTCGGATAATAATAATAATAATAATAGTAATAATGA
TAATAAGAATTGGGGATTTAGCGAGGATAGAAGTAAGTCATTTCCAATGATGAACTCATCAACATCACCTGCTTCGCCTTCCTCTTATCT
TGCTTTTCCGCATTCATTAAGTCCATCTATGCTTTTGGACTCGCCCGTTTTGTTCAACAATTCTAATACTCTTTCATCGCCAACTACAGG
GAGTTTTGGTAATTT
Reverse sequence
AAATTACCAAAACTCCCTGTAGTTGGCGATGAAAGAGTATTAGAATTGTTGAACAAAACGGGCGAGTCCAAAAGCATAGATGGACTTAAT
GAATGCGGAAAAGCAAGATAAGAGGAAGGCGAAGCAGGTGATGTTGATGAGTTCATCATTGGAAATGACTTACTTCTATCCTCGCTAAAT
CCCCAATTCTTATTATCATTATTACTATTATTATTATTATTATTATCCGAAAGAAGATCGCTAAACGAAGAAGTCATGAATTGAGAAGAA
GAAAATGAGTTAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1445952.5e-2659 (20.7% of RFLP seq)+
SGN-U1445955.8e-92189 (66.3% of RFLP seq)+
SGN-U1445952.5e-2659 (20.7% of RFLP seq)-
SGN-U1445955.8e-92189 (66.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9509)
Chromosome
9
Position
56.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT235 was used as an overgo probe on plate 16 [well G5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P166F22,   P007G04,   P173C12,   P132M01,   P255D15,   P331M21,   P016M20,   P259F23,   P255D14

 Overgo Sequences

A sequence
TGATGAACTCATCAACATCACCTG
B sequence
TAAGAGGAAGGCGAAGCAGGTGAT
AB sequence
TGATGAACTCATCAACATCACCTGCTTCGC
Marker sequence
ATTTAACTCATTTTCTTCTTCTCAATTCATGACTTCTTCGTTTAGCGATC
TTCTTTCGGATAATAATAATAATAATAATAGTAATAATGATAATAAGAAT
TGGGGATTTAGCGAGGATAGAAGTAAGTCATTTCCAATGATGAACTCATC
AACATCACCTGCTTCGCCTTCCTCTTATCTTGCTTTTCCGCATTCATTAA
GTCCATCTATGCTTTTGGACTCGCCCGTTTTGTTCAACAATTCTAATACT
CTTTCATCGCCAACTACAGGGAGTTTTGGTAATTT
Genomic location of CT235  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D571 marker 571
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)