SGN Marker CT163

SGN-M572

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTTTAACACCCAAAGAACAAAAATATATTAAGGCCTAGTGATACATCAGAGGGTACAAAATCAAATTTGCACAACT
TGAAGTACAGTCTAGCTCATTTGAGCTTTGATTAAAATTATTCCTCAATTTTTAGAGCAATCTAACAAGCTGCAAACACCTACTAACAAC
TATTACAGAGTGAAATTGTGACAGATGAATTACAATCCTCATTTGGGAGGGTGACGATTGGCAATATCTGTTATCCATTGATCGCTGTAC
CCAAAAAACAGAATGCATGATAGTTTTGTTTCTGCTAACACTGATACATATTTCTACAAATTGTGAAATGAAGATTTCTCTTCATTTATG
TCAATATTCTGGAATCAATCCAACTCATTGTCATCATTGAATCAAGAATCTGGGTTTAAGTTACTACTTACATCTCAGTACATTGGTCGT
TAACATTTGACACAAATTTAATCCCGAAGACCCAGCTCAAGCTCAAGCTCATCATC
Reverse sequence
AAACAGGGAGATGAAAGGGGTCTCTAATGGGAGATCCATTCCCTTTCTTCTCTTCTTCCTTTCGTTTTTTCATCAATTCATCACAGGCTT
TTCAGACGATTCTTTAAATCCCAGAAATGGAACAAAAGTTGATAGTCATGCTGCATCCAGCAGTAACACTGGGTCAATTGTACTCATTGT
ATGTGTTGCCCTTGTGGCAGTAGTGCTTCTATCATTTTTCCTTTTCAAGTTTTGGCAAAAGAAGAAGCGTGAAGAGCAGTATGCTCGTCT
GCTAAAGTTGTTTGAAGAAGATGATGAGCTTGAGCTTGAGCTGGGTCTTCGGGATTAAATTTGTGTCAAATGTTAACGACCAATGTACTG
AGATGTAAGTAGTAACTTAAACCCAGATTCTTGATTCAATGATGACAATGAGTTGGATTGATTCCAGAATATTGACATAAATGAAGAGAA
ATCTTCATTTCACAATTTGTAGAAATATGTATCAGTGTTAGCAGAAACAAAACTATCATGCATTCTGTTCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1495101e-168322 (63.6% of RFLP seq)+
SGN-U1583424.3e-17108 (20.7% of RFLP seq)-
SGN-U149510521 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53451)
Chromosome
1
Position
94.35 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Eggplant-COSII   
Map version
63 (location: 42306)
Chromosome
1
Position
126.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38986)
Chromosome
1
Position
129.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9511)
Chromosome
1
Position
140.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9510)
Chromosome
1
Position
96.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT163 was used as an overgo probe on plate 5 [well F1]

Plausible BAC Matches:   P201L04,   P244G10,   P024O06,   P231O06,   P135L24,   P122H22,   P187O23,   P268G14,   P313B23,   P226G18,   P120L24,   P315K20,   P026N10,   P307M14,   P292B04,   P074H11

 Overgo Sequences

A sequence
GACGATTGGCAATATCTGTTATCC
B sequence
GGGTACAGCGATCAATGGATAACA
AB sequence
GACGATTGGCAATATCTGTTATCCATTGAT
Marker sequence
CTTTTTTTTTTTTTTTTTAACACCCAAAGAACAAAAATATATTAAGGCCT
AGTGATACATCAGAGGGTACAAAATCAAATTTGCACAACTTGAAGTACAG
TCTAGCTCATTTGAGCTTTGATTAAAATTATTCCTCAATTTTTAGAGCAA
TCTAACAAGCTGCAAACACCTACTAACAACTATTACAGAGTGAAATTGTG
ACAGATGAATTACAATCCTCATTTGGGAGGGTGACGATTGGCAATATCTG
TTATCCATTGATCGCTGTACCCAAAAAACAGAATGCATGATAGTTTTGTT
TCTGCTAACACTGATACATATTTCTACAAATTGTGAAATGAAGATTTCTC
TTCATTTATGTCAATATTCTGGAATCAATCCAACTCATTGTCATCATTGA
ATCAAGAATCTGGGTTTAAGTTACTACTTACATCTCAGTACATTGGTCGT
TAACATTTGACACAAATTTAATCCCGAAGACCCAGCTCAAGCTCAAGCTC
ATCATC
Genomic location of CT163  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D572 marker 572
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)