SGN Marker TG406

SGN-M574

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG406 image not available
Forward sequence
GCCCACCAATAGTGTCAAGGGCCTAGCTGGAAGCTCCATTGCTGGAACTAAGCTGAATGTTAAATCATCTCGCCTCAATGTGAAGCAATC
TAAATCCAGGTAAGGTACTGGATGGCCGATGTCTCAGATTTTAGTAGCCCGTTTGATCAATATCTGCTTATTTCAATTTTAGGAAGTCTT
ATTGTTTTAGCAATTTGTGTTTGACGAATCAACTTGCAAAGCAATTTGTCAATATTAGAAAAAACAGTTGTGATTGACTGATTAACGCTC
CAAAACTTCAATTTCTGAAAAACAACTTCTATTACTGCTCACAACTACTTATTTATTCCTAAAATGTTTAGCCAAGCAACTTGGACTTTA
GTTTGGTTAGTGGTGAAGTTAAAGATTGAATTAGTTTTTTTCTTAATAACCATGGTGTGTGTTCGACTACCTGTTACCTCCCACCAATAT
CGGTTTATCTGAGGATGTTAAGAAATGTTATTATATACATTTGA
Reverse sequence
CTCCTATAGGGAGACAGCTTGCATGCCTGCAGAATTTTAGTTTACCTCACGAGGACTGCCATCAGAATTCACGGAATTCTGGAAGCTCGT
CCTCAAATGTACATATTCAGATGGATCTCACCCATATAGGATTCAACTAAGCCATTCCTTTTGTAAGTAGGGAAAATTTAGTAGACCTAT
CGAGTCTGTGGCACTTCTTTTGAAGTGATTTACTGTGTACAAGATGTCACCTTGTTGAAAAAACAAAGTGAATTTTTTGATTTTTTGCAA
ATAGTACTATGTTATTTTGTATGGCCTTTGGTCTTTAGATTTTATTGGAAAGGAAGTATGTAAGAGAGATTTGTTGTCCTTATCAGTCTA
CCTTTTCTTTCATGTTCTTTTCAGAGTATTGTTTACAATATCACAAAGGCATGATGAACCACGAAGATGAAAAAAAATATCATAAGCTAC
AAACTTCGAAAGCAATGCTTTGAACTTTCCAGAAGATTTATCTTGTTGTAACAGAGGTCTGAGGTAAGCTTTAATGTACACTTACAAGCT
GTTATATAGATGATACATC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1555533.6e-0865 (13.2% of RFLP seq)+
SGN-U1555541.1e-2062 (12.6% of RFLP seq)+
SGN-U1555523.8e-48100 (20.2% of RFLP seq)+
SGN-U1555521.8e-53105 (18.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40033)
Chromosome
6
Position
44.60 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40034)
Chromosome
12
Position
57.40 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9516)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9515)
Chromosome
3
Position
111.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG406 was used as an overgo probe on plate 4 [well A1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P081D06,   P160H23,   P123J17,   P256F11,   P105G19,   P167N10,   P059M05,   P210O03,   P130N06,   P155H16,   P336G23,   P243M03,   P329A07,   P314P16,   P176P16,   P106H01,   P312P10,   P250E17,   P317C19,   P122E10,   P100G22

 Overgo Sequences

A sequence
GTGTGTGTTCGACTACCTGTTACC
B sequence
ACCGATATTGGTGGGAGGTAACAG
AB sequence
GTGTGTGTTCGACTACCTGTTACCTCCCAC
Marker sequence
GCCCACCAATAGTGTCAAGGGCCTAGCTGGAAGCTCCATTGCTGGAACTA
AGCTGAATGTTAAATCATCTCGCCTCAATGTGAAGCAATCTAAATCCAGG
TAAGGTACTGGATGGCCGATGTCTCAGATTTTAGTAGCCCGTTTGATCAA
TATCTGCTTATTTCAATTTTAGGAAGTCTTATTGTTTTAGCAATTTGTGT
TTGACGAATCAACTTGCAAAGCAATTTGTCAATATTAGAAAAAACAGTTG
TGATTGACTGATTAACGCTCCAAAACTTCAATTTCTGAAAAACAACTTCT
ATTACTGCTCACAACTACTTATTTATTCCTAAAATGTTTAGCCAAGCAAC
TTGGACTTTAGTTTGGTTAGTGGTGAAGTTAAAGATTGAATTAGTTTTTT
TCTTAATAACCATGGTGTGTGTTCGACTACCTGTTACCTCCCACCAATAT
CGGTTTATCTGAGGATGTTAAGAAATGTTATTATATACATTTGA
Genomic location of TG406  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D574 marker 574
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)