SGN Marker CA524065

SGN-M5756

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14209)
Chromosome
5
Position
72.21 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34395
Forward primer (5'-3')
TCTCTCTCTACATCTCTCCGTTG
Accessions and product sizes
Capsicum frutescens BG2814-6
233
Capsicum annuum NuMex-RNaky
233
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTCGTTCGTCGACGTACTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of CA524065  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5756 marker 5756
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)