SGN Marker TG333

SGN-M576

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG333 image not available
Forward sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGGTTCAACACAGATGTTCTGGCTATGCCTCTGCCTCTGCCTCTTTGTGATGATTTAAC
TTGCTAGGTTCTCAGAAATCTAATGGTCAACCTGAAAAACAAAGTGATCATATGAGCTAGTTGGGTTATGTTCCGGTTTGTTTGACCCAT
TTTCAACTCATTTGCCGTCACTACTATTATGTTACGGGGAATATCTTACATATTCTTTGTTTAATCTTTATATGGAGATGTATTTAGTTT
TTATGTCGTGATAAAATCATCTTACATAAGCAAATTAATGATCAATACATGATGGTATATTGATTCCTGAAAGAAACATAAAGTACATTG
AGTATTGGTCACTAAAACAAGACAAGCAGGGCATTCTTGTTGTTGACACAAATATCAAGTAACTTTGTTCACCAAAATTAAGCATATGTC
ATTATATTGTGTGATCTTATCAGAACAATTTATTATGTACTTGCTTTGTTTCAACAATGGTAAATTGACCAAATTGTTTCAATTGGTTGA
TTTTAACAAATAAGGTAGTAGTTTTTT
Reverse sequence
CTCACTATAGGGAGACAGCCTGCATGCCTGCAGGTTCAACACAGATGTTCTGGCTATGCCTCTGCCTCTGCCTCTTTGTGATGATTTAAC
TTGCTAGGTTCTCAGAAATCTAATGGTCAACCTGAAAAACAAAGTGATCATATGAGCTAGTTGGGTTATGTTCCGGTTTGTTTGACCCAT
TTTCAACTCATTTGCCGTCACTACTATTATGTTACGGGGAATATCTTACATATTCTTTGTTTAATCTTTATATGGAGATGTATTTAGTTT
TTATGTCGTGATAAAATCATCTTACATAAGCAAATTAATGATCAATACATGATGGTATATTGATTCCTGAAAGAAACATAAAGTACATTG
AGTATTGGTCACTAAAACAAGACAAGCAGGGCATTCTTGTTGTTGACACAAATATCAAGTAACTTTGTTCACCAAAATTAAGCATATGTC
ATTATATTGTGTGATCTTATCAGAACAATTTATTATGTACTTGCTTTGTTTCAACAATGGTAAATTGACCAAATTGTTTCAATTGGTTGA
TTTTAACAAATAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9523)
Chromosome
1
Position
101.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG333 was used as an overgo probe on plate 4 [well G11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACTATAGGGAGACAGCTTGCATGC
B sequence
TGTGTTGAACCTGCAGGCATGCAA
AB sequence
ACTATAGGGAGACAGCTTGCATGCCTGCAG
Marker sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGGTTCAACACAGATGTTC
TGGCTATGCCTCTGCCTCTGCCTCTTTGTGATGATTTAACTTGCTAGGTT
CTCAGAAATCTAATGGTCAACCTGAAAAACAAAGTGATCATATGAGCTAG
TTGGGTTATGTTCCGGTTTGTTTGACCCATTTTCAACTCATTTGCCGTCA
CTACTATTATGTTACGGGGAATATCTTACATATTCTTTGTTTAATCTTTA
TATGGAGATGTATTTAGTTTTTATGTCGTGATAAAATCATCTTACATAAG
CAAATTAATGATCAATACATGATGGTATATTGATTCCTGAAAGAAACATA
AAGTACATTGAGTATTGGTCACTAAAACAAGACAAGCAGGGCATTCTTGT
TGTTGACACAAATATCAAGTAACTTTGTTCACCAAAATTAAGCATATGTC
ATTATATTGTGTGATCTTATCAGAACAATTTATTATGTACTTGCTTTGTT
TCAACAATGGTAAATTGACCAAATTGTTTCAATTGGTTGATTTTAACAAA
TAAGGTAGTAGTTTTTT
Genomic location of TG333  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D576 marker 576
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)