SGN Marker TG261

SGN-M577

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG261 image not available
Forward sequence
CCGTGTGCTGGCACATTTATGATTCAGTTCTCAGAATGTGATTGGCATTATTTGCCTGAACTTTAAATGAGAGTTAACTGTTCGTATCCA
ATTGGGATTTACATGGATACATGCTATGGTTCACTGCTTCTTCCTATTCTGTATGTTCAGCAATACACTTCTCCATTACACTTGCCTTGT
GACAGTTCTAGGGTGATGTTGATAAGCGTGATAATATCTCTTCTTCTCCAGCATAGTTCTATGTATATGATGGGCAGTTAGTTTCAAAAG
TTTTGGTATTTATGCTTCGTCATGATGCTTAATTAAGAGCCATTTTTTTAACATTTAATTTTTTTTTCCAAAAGAGCCAGATCCATATAG
GTAATATCAGTTAGTTAAGACGCAGCTAATTATTTTTCAATGAACAGGTGTTTGGTTTAGATAAACCATAATTGCCTTTAAAAGGCCAAG
TATTATGCATTGGAATGAAATGGGCCTGAATGGATATAGAG
Reverse sequence
AATCAAAATTTCTGCTGAACCTGCGCCCCTCTTAGCAAAGGTCAACTAGCTGTTCATTTGGGTCTCAAATAGGAAAGAGAAAGAGTTTGG
TCCAACTTCCCTTCTCCTCCTTCATTCTCTATTAAATAGAATGACCCCCCCCCCCAAAAGGTTCACCAACAAATATCACTAAACCTCTCA
TTAGGCTGCCAAATTTAGTTTAAGAAAAGCTTCCAATAATTTGAAGTATTAAACCAAAGTGGACTTCCCATAAAAACTAACCTCAGGGTC
CTCCAAAGCACCAGCAACCTCATGAAAATCAATTTTGGGTGCCACAGATATGCCAGCTCCATGAAAAGATACAACTCTTTTCTCTCCGAT
ATTTTTCTCAACCTGTACTATCGCAAGCAGGGATATGTAAAAAAACATAGTCATCACAGAAACAAACATAATTGACACAGGACCAACCTG
GGCGGGAGGGGGCATAATATCATGGCACAATATTGCTAGAGGATAAATGTGACCAGGGACACC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1588254.2e-57111 (22.6% of RFLP seq)+
SGN-U1588259e-157278 (56.6% of RFLP seq)+
SGN-U1512691.3e-3270 (13.6% of RFLP seq)-
SGN-U1512691.8e-59115 (22.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53240)
Chromosome
8
Position
88.76 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9524)
Chromosome
8
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9525)
Chromosome
8
Position
28.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG261 was used as an overgo probe on plate 12 [well C5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P106E03,   P100E10,   P047J02,   P003P22,   P320P23

 Overgo Sequences

A sequence
CACTTCTCCATTACACTTGCCTTG
B sequence
CACCCTAGAACTGTCACAAGGCAA
AB sequence
CACTTCTCCATTACACTTGCCTTGTGACAG
Marker sequence
CCGTGTGCTGGCACATTTATGATTCAGTTCTCAGAATGTGATTGGCATTA
TTTGCCTGAACTTTAAATGAGAGTTAACTGTTCGTATCCAATTGGGATTT
ACATGGATACATGCTATGGTTCACTGCTTCTTCCTATTCTGTATGTTCAG
CAATACACTTCTCCATTACACTTGCCTTGTGACAGTTCTAGGGTGATGTT
GATAAGCGTGATAATATCTCTTCTTCTCCAGCATAGTTCTATGTATATGA
TGGGCAGTTAGTTTCAAAAGTTTTGGTATTTATGCTTCGTCATGATGCTT
AATTAAGAGCCATTTTTTTAACATTTAATTTTTTTTTCCAAAAGAGCCAG
ATCCATATAGGTAATATCAGTTAGTTAAGACGCAGCTAATTATTTTTCAA
TGAACAGGTGTTTGGTTTAGATAAACCATAATTGCCTTTAAAAGGCCAAG
TATTATGCATTGGAATGAAATGGGCCTGAATGGATATAGAG
Genomic location of TG261  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D577 marker 577
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)