SGN Marker CT165

SGN-M578

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT165 image not available
Forward sequence
CATTTCTTTTGCTGGACCAGCAGCTTCTACTACACCCGCGTCTTCACGGCTGATGCCTGTAGGTCAAAACAAGAGACACAAACTGATAAA
TGAAATGGAACCCGACTCTAGCCCACTGCTGAAGCCGCAGACACGTGGAACACTCCATGCCGGTGAAGATGCCAAGGCTAAGAGTCATAT
GGCTCAAAGAGAAACAAGATTTGGTGGTAGCAGTAGCCGGGAGCTTAGCCAACAGGATGATTCACGCCCATTCACTCATCCCGGGGAGCT
TGTTATTTGCAAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTGCAAATAACAAGCTCCCCGGGATGAGTGAATGGGCGTGAATCATCCTGTTGGCTAAGCTCCCGGCTACTGCTACCA
CCAAATCTTGTTTCTCTTTGAGCCATATGACTCTTAGCCTTGGCATCTTCACCGGCATGGAGTGTTCCACGTGTCTGCGGCTTCAGCAGT
GGGCTAGAGTCGGGTTCCATTTCATTTATCAGTTTGTGTCTCTTGTTTTGACCTACAGGCATCAGCCGTGAAGACGCGGGTGTAGTAGAA
GCTGCTGGTCCAGCAAAAGAAATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1539293e-158280 (95.2% of RFLP seq)+
SGN-U1539293e-158280 (95.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38987)
Chromosome
1
Position
78.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9526)
Chromosome
1
Position
63.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT165 was used as an overgo probe on plate 5 [well G12]

Plausible BAC Matches:   P238A10,   P200A12,   P275H18,   P003B11,   P330M12,   P164J23,   P034P21,   P003N02,   P222J09,   P130J08,   P210I04,   P007A19,   P187M04,   P123F02,   P149J01

 Non-Plausible BAC matches

P252I09,   P271H07,   P186M16,   P267F23,   P027J04,   P266F23,   P172K16,   P022G10,   P072B06

 Overgo Sequences

A sequence
TTTTGCTGGACCAGCAGCTTCTAC
B sequence
TGAAGACGCGGGTGTAGTAGAAGC
AB sequence
TTTTGCTGGACCAGCAGCTTCTACTACACC
Marker sequence
CATTTCTTTTGCTGGACCAGCAGCTTCTACTACACCCGCGTCTTCACGGC
TGATGCCTGTAGGTCAAAACAAGAGACACAAACTGATAAATGAAATGGAA
CCCGACTCTAGCCCACTGCTGAAGCCGCAGACACGTGGAACACTCCATGC
CGGTGAAGATGCCAAGGCTAAGAGTCATATGGCTCAAAGAGAAACAAGAT
TTGGTGGTAGCAGTAGCCGGGAGCTTAGCCAACAGGATGATTCACGCCCA
TTCACTCATCCCNNNNAGCTTGTTATTTGCAAAAAAAAAAAAAA
Genomic location of CT165  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D578 marker 578
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)