SGN Marker CT166

SGN-M579

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CAGGGGATTGTCTTAGTATCATTTCTCCTTATTTTTCCTTCTTCACCATTCCCCCCCTCTTAATTCTCTTTACTCATAATTCATAAAAAA
ACATGGCTACTGCAGTAAGTGCTGCAGTTTCTCTTCCTTCATCCAAGTCCACCTCCTTTTCCTCTAGAAACTCCATCATCTCTACAGACA
AAATCAACTTCAACAAGGTGCCCTTGTACTACAGAAATGTGTCTGGTGCTAGTAGATTAGTTTCTATCAGAGCCCAAGTGACCACTGAGG
CTCCTGCTAAAGTTGAGAAGATTTCAAAGAAACAGGAGGAAGGTGTGATTGTCAATAAATTCAGGCCAAAGGAACCTTATGTTGGTAGAT
GTCTGCTAAACACTAAGATCACTGGTGATGATGCACCTGGAGAAACTTGGCATATGGTTTTCAGCACTGAGGGAGAGGTCCCATATATAG
AAGGACAATCCATTGGGGTAATTGCTGATGGTGTTGATGCCAATGGGA
Reverse sequence
CCTTGTAAAGTAGTGAGCTGCTGGTGGGAACACCCAAGAAAAGCCATGCTGTACCGTTGAACTTGTAATCCTCGTGTTTCTCAAAGAACA
TTTTCCACAGGAATGAACGGAAAGGAGCAATTCCAGTTCCAGTGGCAAGCATTATAACGGTGGCATTTGGATCTTTAGGCATGAGCATTT
CTTTGCCTACAGGTCCAGTAATCTTGACCTCTGCTCCAGGCTTCAAGTCACATAAGAAGTTTGAGCAAACTCCTTTAACTTCTTCCCCTT
TGTCATTGGTGTACACAAGCCTCTTGACACACAGGGAAACAGTTTTGGAGTCACCGAAGTCACCAAGGGCACTGCTAGCAATTGAGTACA
ATCTAAGCTTGTGAGGCTTCCCATTGGCATCAACACCATCAGCAATTACCCCAATGGATTGTCCTTCTCTATATGGGACCTCTCCCTCAG
TGCTGAAAACCATATGCCAAGTTTCACCAGGTGCATCATCACCAGTGATCTTAGTGTTTAGCAGACATCTAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1550317.4e-28122 (24.5% of RFLP seq)+
SGN-U143166479 (96.2% of RFLP seq)+
SGN-U1550314e-1150 (9.6% of RFLP seq)-
SGN-U1603302.8e-2151 (9.8% of RFLP seq)-
SGN-U1603303e-2464 (12.3% of RFLP seq)-
SGN-U1603313.7e-42146 (28.0% of RFLP seq)-
SGN-U143166522 (100.0% of RFLP seq)-
Mapped locations  
Map: Pepper-AC99   
Map version
34 (location: 9530)
Chromosome
2
Position
86.13 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9529)
Chromosome
2
Position
71.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT166 was used as an overgo probe on plate 6 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCACCTGGAGAAACTTGGCATATG
B sequence
CCTCAGTGCTGAAAACCATATGCC
AB sequence
GCACCTGGAGAAACTTGGCATATGGTTTTC
Marker sequence
CAGGGGATTGTCTTAGTATCATTTCTCCTTATTTTTCCTTCTTCACCATT
CCCCCCCTCTTAATTCTCTTTACTCATAATTCATAAAAAAACATGGCTAC
TGCAGTAAGTGCTGCAGTTTCTCTTCCTTCATCCAAGTCCACCTCCTTTT
CCTCTAGAAACTCCATCATCTCTACAGACAAAATCAACTTCAACAAGGTG
CCCTTGTACTACAGAAATGTGTCTGGTGCTAGTAGATTAGTTTCTATCAG
AGCCCAAGTGACCACTGAGGCTCCTGCTAAAGTTGAGAAGATTTCAAAGA
AACAGGAGGAAGGTGTGATTGTCAATAAATTCAGGCCAAAGGAACCTTAT
GTTGGTAGATGTCTGCTAAACACTAAGATCACTGGTGATGATGCACCTGG
AGAAACTTGGCATATGGTTTTCAGCACTGAGGGAGAGGTCCCATATATAG
AAGGACAATCCATTGGGGTAATTGCTGATGGTGTTGATGCCAATGGGA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT166  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D579 marker 579
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)