SGN Marker asu7

SGN-M5797

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14255)
Chromosome
6
Position
32.13 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34776
Forward primer (5'-3')
GTGTCTTCCCTCCTTCACAGTGCTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCTCTCTGTTTCTTATGTTTTGCGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Umesh Reddy
Organization: Alcorn State University
Genomic location of asu7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5797 marker 5797
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)