SGN Marker TG409

SGN-M580

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG409 image not available
Forward sequence
CTATGGGTCTACAAAATGTGGTCTCAGGCAGCTTCAATCATCCCTACTGAAGGAGTGCAAGCGGTCAAAAGTTGGAGTGCATACGGCGTC
TCCAGGCATGGTCCTAACCGACCTACTTCTGAGGTATGTGAAGAGGATCATCGGATCTTTGCACTTAAATGTCTTTTGCGTTGCTTTCAT
GGACAATGTATTGCTGTAGAAGGATAACTCTGTCCGGTTTGGTATTATTTCTGGTAGTGCTACCAAGGAGGACTAGTTATCCACACCATT
CAGCGGTACATAAAGACTACAGTAATGTCTAGAACAGAGATTCTTACCTCTTATATAATTCTCTTTTCTGGTGTGCAAGGAATGATGAAA
ATTTCAACTTCTTTTTTTGTTATAGTAATCAATTGTGATCACTTCTTCTAATCCTTCCGTAATGGTAAAACTGGAGCCTAATTTAGTGAT
CTCCCTTTTATACTCGATCTCCAATGCCTACGATTACATATAATGGGTGGTTTTGGCTGA
Reverse sequence
TATAGGGAGACAGCTTGCATGCCTGCAGGAGAGTCTCATTATTAATAAACTGAACTATAAAATGATTTGATATGGTAAGAATGAAAACCC
AAAAGAAAAGTATAAAGTTCTAAACAGTTTTAATAGTTAAAACAAAGAAAGCCTAATTATGTAGATGAGTATCATTATTAACCTTCTCCA
TGCGGCAAAATTAGCCGAAGAAAACATAACCTGCCCATGTTTCAATGGGCTATTGACCCGACCATTTATTAGCACAACCAACCAATTTCA
GCCCAATTTCTATTGCATTGATATGTAGCATAAATTGACTCATGAGCAATCTTGTCAACATATTTTCAAAAAGACTCTTTCTAAATTTGA
TATGTTATGTATAGTCGTAATAAAGGAAAACTAGTTTTATAAAGTCCAAAAAAAGAAACAATTTTAAAGAACAAACAAAGCATTAAAACT
TAATAAGAATTGGATTGGTTGGATACCCGCATTTTGACCCATTTCAGTCCAATCCATAGCAAGNTAACATTTTGGGTGGGTCAATAACCC
ACCCATTTATTAACTCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1507102.4e-0931 (6.1% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9531)
Chromosome
9
Position
63.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG409 was used as an overgo probe on plate 15 [well G2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATCCCTACTGAAGGAGTGCAAG
B sequence
CTCCAACTTTTGACCGCTTGCACT
AB sequence
TCATCCCTACTGAAGGAGTGCAAGCGGTCA
Marker sequence
CTATGGGTCTACAAAATGTGGTCTCAGGCAGCTTCAATCATCCCTACTGA
AGGAGTGCAAGCGGTCAAAAGTTGGAGTGCATACGGCGTCTCCAGGCATG
GTCCTAACCGACCTACTTCTGAGGTATGTGAAGAGGATCATCGGATCTTT
GCACTTAAATGTCTTTTGCGTTGCTTTCATGGACAATGTATTGCTGTAGA
AGGATAACTCTGTCCGGTTTGGTATTATTTCTGGTAGTGCTACCAAGGAG
GACTAGTTATCCACACCATTCAGCGGTACATAAAGACTACAGTAATGTCT
AGAACAGAGATTCTTACCTCTTATATAATTCTCTTTTCTGGTGTGCAAGG
AATGATGAAAATTTCAACTTCTTTTTTTGTTATAGTAATCAATTGTGATC
ACTTCTTCTAATCCTTCCGTAATGGTAAAACTGGAGCCTAATTTAGTGAT
CTCCCTTTTATACTCGATCTCCAATGCCTACGATTACATATAATGGGTGG
TTTTGGCTGA
Genomic location of TG409  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D580 marker 580
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)