SGN Marker TG191

SGN-M581

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
555
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CACTTCAGTGTCATGATTGGATAATCTCGTTCTGCTGATTTGGCGATGCTTAAAGATCTGCAAACTTTGCTGGTAGGAGTTATCATCATT
CCGAGGAAATATATAATGGGAAAGGTAGATGACAGGGCTATCAAGACTCTTGTACTATTGATCTCATCATCAATATGCATCCTAATCATT
GGATGTGTCTG
Reverse sequence
CTCGTTCTGCTGATTTGTCGATGCTTAATGATCTGCAAACTTTGCACGTAGGAGTTATCATCATTCCAAGGAAATATATAATGGGAAAGG
TAGATGAGAGGGCTATCAAGACTCTTGTAATATTGATCTCAGCATCAATATGCATCCTAATCATTGGATGTGTCTGCATCTTCGTACTAA
CAGATGGAGTGTCAAAGGAAATGAAACTTAGAGCAGAGCTGATAAGCCAGTTAGATGCAAGAAGGAAAGCAGAGGCATCGAGCAATTACA
AAAGCCAATTTCTAGCGAACATGAGGTGAATATTCATCAGTCCTTTGTTACTTCCGCTCTTCTACTCTACATCTTGCCTCTGCGAAAGAC
TCATTCTCAGTTTAAATTTTTAGTTTCTCAAATGTACATTTCTACAGTTACTTCATGCTATGTTTTTTCACAGTCATGAATTACGAACAC
CT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39935)
Chromosome
2
Position
83.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9532)
Chromosome
2
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG191 was used as an overgo probe on plate 6 [well D2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGTGTCATGATTGGATAATCTCG
B sequence
CGCCAAATCAGCAGAACGAGATTA
AB sequence
CAGTGTCATGATTGGATAATCTCGTTCTGC
Marker sequence
CACTTCAGTGTCATGATTGGATAATCTCGTTCTGCTGATTTGGCGATGCT
TAAAGATCTGCAAACTTTGCTGGTAGGAGTTATCATCATTCCGAGGAAAT
ATATAATGGGAAAGGTAGATGACAGGGCTATCAAGACTCTTGTACTATTG
ATCTCATCATCAATATGCATCCTAATCATTGGATGTGTCTG
Genomic location of TG191  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D581 marker 581
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)