SGN Marker GPMS178

SGN-M5821

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41597)
Chromosome
6
Position
122.90 cM
Confidence
I(LOD2)
Protocol
SSR
Subscript
A


Pepper-COSII

PCR data   Exp. ID 43565
Forward primer (5'-3')
GATTTTTGACATGTCACATTCATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACGTTGAAAAATAAAGTAAGCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14283)
Chromosome
4b
Position
93.00 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A


Pepper-FAO3

Map: Pepper-FAO3   
Map version
31 (location: 14282)
Chromosome
2
Position
111.16 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B


Pepper-FAO3

Map: Pepper-FAO3   
Map version
31 (location: 14281)
Chromosome
2
Position
142.85 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C


Pepper-FAO3
Genomic location of GPMS178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5821 marker 5821
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)