SGN Marker TG264

SGN-M583

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1080
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG264 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGGGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTT
GATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAG
ATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAG
GCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGG
TTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGAT
TCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTT
Reverse sequence
TTTCCAACATTGTCATGTCTATTGTTGTGGTCCTGACATTGTTGTTCATAACCCCTCTTTTTGAGTACACTCCGAATGCAATACTCTCTG
CCATCATTATCTCTGCTGTCATTGGATTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCA
TGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTGAGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTC
ATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTTATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCA
AGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATATAGGAACATTCAACAATATCCCGAGGCAACACAAGT
TCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1595963.4e-0544 (9.0% of RFLP seq)-
SGN-U1680862.2e-0626 (5.3% of RFLP seq)-
SGN-U1595961.3e-35227 (46.6% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42428)
Chromosome
4
Position
65.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39969)
Chromosome
4
Position
75.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9541)
Chromosome
4
Position
46.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9540)
Chromosome
4
Position
58.40 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG264 was used as an overgo probe on plate 10 [well A5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGACAGCATCTCCTACAGTGAGA
B sequence
GCGAGGACAAGATCTTTCTCACTG
AB sequence
AGGACAGCATCTCCTACAGTGAGAAAGATC
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGGGGACTTTGCGGAACAGGTCAGGACA
GCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAA
ATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAA
CTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAA
TTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGC
TTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTC
ACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTA
TCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACT
TACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGAT
TCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAA
GTTCATTCTCATGAATCAGACACTCTTTT
Genomic location of TG264  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D583 marker 583
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)