SGN Marker GP1102

SGN-M5830

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41583)
Chromosome
7
Position
24.90 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43551
Forward primer (5'-3')
GAACCCTTCATTCCTGTATGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGCCCGCATTATGTAAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14293)
Chromosome
7
Position
26.06 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34688
Forward primer (5'-3')
Unknown
Accessions and product sizes
Capsicum frutescens BG2814-6
144
Capsicum annuum NuMex-RNaky
143
Approximate temperature
Unknown
Reverse primer (5'-3')
Unknown
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Organization: DNA Landmarks
Genomic location of GP1102  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5830 marker 5830
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)