SGN Marker TG192

SGN-M584

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
850
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTACAAGTTCAAGTAAAGAGGCCGTAGTGCTAGTCACACATGTTATAGTAGTGCCACCTTTTGCGCCAGAGAAGTTCTAAATAGATTCA
GAAGACCTACAAGACTTAACCATAGTATGCATCTGAAGTTTCAAGAAGTTTATGTTTTGATGTGATGCTATTATTATCAATGATGATGAC
GTAAATTCTTTGGAGTTTATGTTTGTAAATACTCCACACATTAATAAAATAAAGTTGTATTTGATAGGACTGTATTGACAAATACTCCAT
CCATTACATGCTATTTGGAATTTTGGAGGATTTTTTTTTTTTTGGTGTATAATAGCAATGATCTGTTCATTTAGTCATCTTAAGATATTA
GGTTCAATTCTATCATAGTTTTTACCAATAAGGTATTGCTAGCTGATTTCCTGTTTAAATCATTATGTTGCTCTGTTTTTTTCTGGAATT
ACATCTTTGAATAGCTGATGATTTATGCATTCTCTATCAGAT
Reverse sequence
TATAGGGAGACAGTTTGCATGCCAACAGGTTTATATGCAATTCCTTGTTTGAAAAAGTAATTGCTAATTATGTAATTTATTCATGTTTGT
ATGATATGTGCTTCTTGAGGAAAGTAAATAAGGTTTGTATATAGTTTGTACACATTGTTCTAAAGTAAGTTTCCAAGGAGCTCTCTCTGT
CAATGGGATCAATAAAAATGGTTCTAAACAACAATACCAATCTCCCATTCTTCTGATATTCAGAAGGTAACAAACTACATCTCCCATATG
CAACTCAGCGATGATCCGCCTTACCATTAATTGCCAGAGTCCTGTATTTATTCAACAAATTTATACGTCAGTCATCGTGGAAAGGGGAAA
GAACATAAACACTTCTTGATGAAAAAATGTTCTCATCTGATAGAGAATGCATAAATCATCAGCTATTCAAAGATGTAATTCCAGAAAAAA
ACAGAGCAACATAATGATTTAAACAGGAAATCAGCTAGCAATACCTTATTGGTAAAAACTATGATAGAATTGAACCTAATATCTTAAGAT
GACTAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9544)
Chromosome
1
Position
56.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9545)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG192 was used as an overgo probe on plate 15 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGCCGTAGTGCTAGTCACACATG
B sequence
GGTGGCACTACTATAACATGTGTG
AB sequence
AGGCCGTAGTGCTAGTCACACATGTTATAG
Marker sequence
TTTACAAGTTCAAGTAAAGAGGCCGTAGTGCTAGTCACACATGTTATAGT
AGTGCCACCTTTTGCGCCAGAGAAGTTCTAAATAGATTCAGAAGACCTAC
AAGACTTAACCATAGTATGCATCTGAAGTTTCAAGAAGTTTATGTTTTGA
TGTGATGCTATTATTATCAATGATGATGACGTAAATTCTTTGGAGTTTAT
GTTTGTAAATACTCCACACATTAATAAAATAAAGTTGTATTTGATAGGAC
TGTATTGACAAATACTCCATCCATTACATGCTATTTGGAATTTTGGAGGA
TTTTTTTTTTTTTGGTGTATAATAGCAATGATCTGTTCATTTAGTCATCT
TAAGATATTAGGTTCAATTCTATCATAGTTTTTACCAATAAGGTATTGCT
AGCTGATTTCCTGTTTAAATCATTATGTTGCTCTGTTTTTTTCTGGAATT
ACATCTTTGAATAGCTGATGATTTATGCATTCTCTATCAGAT
Genomic location of TG192  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D584 marker 584
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)