SGN Marker asu5

SGN-M5840

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41642)
Chromosome
7
Position
32.70 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43598
Forward primer (5'-3')
GGAAGATCCCTTGAATGAGTATGTCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGCTGAAAATGTCTGATGGAACTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14307)
Chromosome
7
Position
38.21 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34559
Forward primer (5'-3')
GGAAGATCCCTTGAATGAGTATGTCTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GGCTGAAAATGTCTGATGGAACTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Umesh Reddy
Organization: Alcorn State University
Genomic location of asu5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5840 marker 5840
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)