SGN Marker TG265

SGN-M585

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG265 image not available
Forward sequence
TTGCATGCCTGCAGCAACAACAGGAATAGTATTGCTTGAGTAAATCTCCTGTCATCATCTCATTCCCCTCGTCCTGATTCTCTATACCAA
ACTCATCCTATTTGCTTCTTATTGTGCTGTGTATCGTTTGGATATTGTGTTGGAGCTCTTCACTGGGCTTAAAACAGTGTGCATCATGTT
TTGATTTGTTCTTTATCACTGTTTGATTGATCTTTTGTATCTTGTTTGGATGATTAATATCATTACATTGTGTTGGTTGTATCTATTATG
ACTCACTTTTTGCCTTTGTATAGGACCATTTGTGGCCACATTTATGTTTTGTTTGTGGGATCAAGGTTTTGGTGGTGTTACTACTAACGA
TTGAGACGTTTAAAAACAAATTAATTGTATAAAGTTCAATTATAACAAGCAGGCTTTAAATATGTATATACACATACATAAAGATTATAT
TAATTTACATTTTTTAACATTCTCACCTACCACTTGTTTTCTATGTAT
Reverse sequence
CTCAAACTCATACATTAACTATGATAATTGTCTGTCTTCGCTTACTGAGTAAAATCACTTCGTATCAATCGGTCACTTTTTTCTGTTTTG
ATTTTTTTTTCTTGTTATTGAACATCATACAACTGGTTAACTGCTAACTTTTAGTTTTACAGCGACATTGTTGTGCAGAAGGGATACTCA
TCCCTCCTATCCTTTACAGTTGGTGATATAAACAATTCGGTAACCAAGCTAATGGTTTTAGGGGCTGAGTTGGATGGTCCTATCAAATAT
GAAATCCATGGAAAGGTAACCAAAATTTTATAAGGCCGCTATTCTACTTAATTATTCCTTCCAAGTTTTAAGCATTAGTATCACTGTCAT
TGTGCACTAACAATCATTATTGAATAATCAGAACTATTTTCTCTAACTGCTAACTGTGATTTCTTTTTCACCAATTAGGCATCCCATTTT
TTTCCTTCTTCCCTTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9546)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG265 was used as an overgo probe on plate 10 [well E4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P123H17,   P270A09,   P293E08,   P318H15,   P320G16,   P318E24,   P012O21,   P280O03,   P297A11,   P064C01,   P115H22,   P278C24,   P229G16

 Overgo Sequences

A sequence
GTTGGAGCTCTTCACTGGGCTTAA
B sequence
CATGATGCACACTGTTTTAAGCCC
AB sequence
GTTGGAGCTCTTCACTGGGCTTAAAACAGT
Marker sequence
TTGCATGCCTGCAGCAACAACAGGAATAGTATTGCTTGAGTAAATCTCCT
GTCATCATCTCATTCCCCTCGTCCTGATTCTCTATACCAAACTCATCCTA
TTTGCTTCTTATTGTGCTGTGTATCGTTTGGATATTGTGTTGGAGCTCTT
CACTGGGCTTAAAACAGTGTGCATCATGTTTTGATTTGTTCTTTATCACT
GTTTGATTGATCTTTTGTATCTTGTTTGGATGATTAATATCATTACATTG
TGTTGGTTGTATCTATTATGACTCACTTTTTGCCTTTGTATAGGACCATT
TGTGGCCACATTTATGTTTTGTTTGTGGGATCAAGGTTTTGGTGGTGTTA
CTACTAACGATTGAGACGTTTAAAAACAAATTAATTGTATAAAGTTCAAT
TATAACAAGCAGGCTTTAAATATGTATATACACATACATAAAGATTATAT
TAATTTACATTTTTTAACATTCTCACCTACCACTTGTTTTCTATGTAT
Genomic location of TG265  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D585 marker 585
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)