SGN Marker CD186

SGN-M587

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pCDNAII
Cutting Site
ECORI
Drug Resistance
AMP
Image
CD186 image not available
Forward sequence
GTGACACTATAGAATCTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCAC
GAGCTTAAATAATGTTATTTGAAGGTTATTAAGTTGTACTCAAGTCTCAATCATGGGAAGCAAGTATTCTAAGGCAACAAATTCCATAAA
TGATGCTTTAAGCTCGAGTTATCTCGTTCCTTTTGAAAGTTATCGAGTTCCTTTAGTAGATTTGGAGGAAGCAACTAATAATTTTGATCA
CAAGTTTTTAATTGGACATGGTGTCTTTGGGAAGGTTTACAAGGGTGTTTTGCGTGATGGAGCAAAGGTGGCCCTGAAAAGGCGTACACC
TGAGTCCTCACAAGGTATTGAAGAGTTCGAAACAGAAATTGAGACTCTCTCATTTTGCAGACATCCGCATCTGGTTTCATTGATAGGATT
CTGTGATGAAAGAAATGAGATGATTCTAATTTATAAATACATGGAGAATGGGAACCTCAAGAGACATTTGTATGGATCAGATCTACCCAC
AATGAG
Reverse sequence
GTGACCTATAGAAACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCACG
AGCTTAAATAATGTTATTTGAAGGTTATTAAGTTGTACTCAAGTCTCAATCATGGGAAGCAAGTATTCTAAGGCAACAAATTCCATAAAT
GATGCTTTAAGCTCGAGTTATCTCGTTCCTTTTGAAAGTTATCGAGTTCCTTTAGTAGATTTGGAGGAAGCAACTAATAATTTTGATCAC
AAGTTTTTAATTGGACATGGTGTCTTTGGGAAGGTTTACAAGGGTGTTTTGCGTGATGGAGCAAAGGTGGCCCTGAAAAGGCGTACACCT
GAGTCCTCACAAGGTATTGAAGAGTTCGAAACAGAAATTGAGACTCTCTCATTTTGCAGACATCCGCATCTGGTTTCATTGATAGGATTC
TGTGATGAAAGAAATGAGATGATTCTAATTTATAAATACATGGAGAATGGGAACCTCAAGAGACATTTGTATGGATCAGATCTACCCACA
ATGAGCATGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1448061.7e-1346 (8.4% of RFLP seq)+
SGN-U1448037.3e-19135 (24.7% of RFLP seq)+
SGN-U1448064.7e-94329 (60.3% of RFLP seq)+
SGN-U1448042e-155404 (74.0% of RFLP seq)+
SGN-U144805404 (74.0% of RFLP seq)+
SGN-U1448061.7e-1346 (8.3% of RFLP seq)-
SGN-U1448037.3e-19135 (24.5% of RFLP seq)-
SGN-U1448061.2e-94338 (61.3% of RFLP seq)-
SGN-U1448044e-159410 (74.4% of RFLP seq)-
SGN-U144805410 (74.4% of RFLP seq)-
Mapped locations  
Map: Pepper-AC99   
Map version
34 (location: 9551)
Chromosome
11
Position
25.98 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Pepper-AC99

Map: Pepper-AC99   
Map version
34 (location: 9552)
Chromosome
12
Position
74.70 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Pepper-AC99

Map: Pepper-AC99   
Map version
34 (location: 9550)
Chromosome
11
Position
38.36 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
C


Pepper-AC99
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CD186  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D587 marker 587
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)