Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TG194

SGN-M588

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
780
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAGGGAGACAGCTTGCATGCCTGCAGAAAAACACAGATGAAAGAAAAGCCAAAAGAGAAGTAACAAAAAAATATTTTACCTTATTCATGA
ATTCATCAAGATCCTCAGCTGTATTCTTTAGTTCTCCGCTTCGAGAGTTTTTAACTTCCTTTGCCATCTCTTTGACTGTTTCTTGTGGAA
ACTTTGCATATTCAATCCTAGCATTCAGCTTCCTTTTCAGAGCCTCCTAAATTTTGAGCAATTGAAACACAATAAGTACATGCATACACA
GAGTTCAAGGGAAACAAAAAGCCTACAAAGTTACATCCAACCGACCAGAGGCACCAACTGTTAGTTGAAGACGCTATACAACCTCCAAAC
ACTCATTTTTTAACTTCAACATGGCACAACCAAATATTGTCCAAACACCTATAACTGGATTTCCCTGTTACAAACTTCCACGAGCAGACA
TATCTATATACGAGCCTATCGAACAGACGCTAACTAGTTTGAAGTTGCAATTACGGCTTCCTAAACTTTCAAGATAATACTCATATCCTT
CAACTTG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAAAAACACAGATGAAAGAAAAGCCAAAAGAGAAGTAACAAAAAAATATTTTACCTTATTCATGAATT
CATCAAGATCCTCAGCTGTATTCTTTAGTTCTCCGCTTCGAGAGTTTTTAACTTCCTTTGCCATCTCTTTGACTGTTTCTTGTAGAAACT
TTGCATATTCAATCCTAGCATTCAGCTTCCTTTTCAGAGCCTCCTAAATTTTGAGCAATTGAAACACAATAAGTACATGCATACACAGAG
TTCAAGGGAAACAAAAAGCCTACAAAATTACATCCAACCGACCAGAGGCACCAACTGTTAGTTGAAGACACTAAACAACCTCCAAACACT
CATTTTTTAACTTCAACATGGCACAACCAAATATTGTCCAAACACCTATAACTGGATTTCCCTGTTACAAACTTCCACGAGCAGACATAT
CTATATACAAGCCTATCAAACAGACGCTAACTAATTTGAAGTTGCAATTACGGCTTCCTAAACTTTCAAGATAATACTCATATCCTTCAA
CTTGCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53210)
Chromosome
11
Position
21.26 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42416)
Chromosome
11
Position
24.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-FAO3   
Map version
31 (location: 9556)
Chromosome
8
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 9555)
Chromosome
11
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9554)
Chromosome
11
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9553)
Chromosome
11
Position
2.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG194 was used as an overgo probe on plate 9 [well H8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAGGCACCAACTGTTAGTTGAAG
B sequence
GGAGGTTGTATAGCGTCTTCAACT
AB sequence
AGAGGCACCAACTGTTAGTTGAAGACGCTA
Marker sequence
TAGGGAGACAGCTTGCATGCCTGCAGAAAAACACAGATGAAAGAAAAGCC
AAAAGAGAAGTAACAAAAAAATATTTTACCTTATTCATGAATTCATCAAG
ATCCTCAGCTGTATTCTTTAGTTCTCCGCTTCGAGAGTTTTTAACTTCCT
TTGCCATCTCTTTGACTGTTTCTTGTGGAAACTTTGCATATTCAATCCTA
GCATTCAGCTTCCTTTTCAGAGCCTCCTAAATTTTGAGCAATTGAAACAC
AATAAGTACATGCATACACAGAGTTCAAGGGAAACAAAAAGCCTACAAAG
TTACATCCAACCGACCAGAGGCACCAACTGTTAGTTGAAGACGCTATACA
ACCTCCAAACACTCATTTTTTAACTTCAACATGGCACAACCAAATATTGT
CCAAACACCTATAACTGGATTTCCCTGTTACAAACTTCCACGAGCAGACA
TATCTATATACGAGCCTATCGAACAGACGCTAACTAGTTTGAAGTTGCAA
TTACGGCTTCCTAAACTTTCAAGATAATACTCATATCCTTCAACTTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG194  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D588 marker 588
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)