SGN Marker CACCEL1i

SGN-M5885

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41562)
Chromosome
1
Position
4.30 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43538
Forward primer (5'-3')
CTCTAATAGGCAATAGCTCACATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCAGTCTCCCAGAACGTTGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14361)
Chromosome
8
Position
9.86 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34720
Forward primer (5'-3')
CTCTAATAGGCAATAGCTCACATGC
Accessions and product sizes
Capsicum frutescens BG2814-6
243
Capsicum annuum NuMex-RNaky
243
Approximate temperature
Unknown
Reverse primer (5'-3')
GCAGTCTCCCAGAACGTTGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Byung-Dong Kim
Organization: Seoul National University
Genomic location of CACCEL1i  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5885 marker 5885
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)