SGN Marker TG268

SGN-M589

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1930
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG268 image not available
Forward sequence
ACTTATTCAATCAAAGTGAATACTCTATAACACATTGCTATAGGGAGATTAATCAAGTGGCGGACAAGACAACTTCTCTTAGTCACAACT
ACAACACCAACATTTTATACTCTAACAGTGGTGAACTCCCCTCCCAAATCAAAGGGCTTATAGCAATTGATTGTTGGAGTCTTTCGTTTA
TAAGAGTCTCCAACAAAAGGAAGACAGATTTTACTTTCGACCCTCCGTGACAAATTCATAAGATCCTCCCATATTTGTGTATAAATGGTA
TTAGTCACATGGGATACCTATCTTAGGCATTTACCTTTTCATCTCAACTACAATAGGTACATTATCCCATATTCCACACGGAGGGAAAAA
TTAGGTTGTGTGTCTGCCTCAAATCAACTGCAATGGTGTGTTTTGGAAGATGAATAAAATTGTTTGTAAAAAAAAAAAA
Reverse sequence
GACTCACTATANGGAGACAGCCTGCATGCCTGCAGGGATGGAAACTGCTGCATCAGGTTTTTCGATGGAGCAAGAGTTGGCTGATTGGTC
GGAACTTCAATATGATCTGCTTGTTCTAATTGCTAGGCGTTTGAATCTCATTGAAGACTATCTAAATTTTGGCACTGTCTGCAAATCCTG
GCACTCTGTGTCCACCAAGGACAATTTCAACAATTACCTCTGTAGAGCTCCTTGGTTGATGCTAGCGGAGGAAGAGGATGATGACGGAAA
TTCCATTCGGAAATTCTTCAGCCTCTATAATGGCATGATTTTGAACAAGAGAATTCCGAAAGCCCGCAGAAAACGGTGTATGGAGTCTAT
GGGTTGGCTTATCATGGTAGGAGAAGAGGAAGGTGAAATTAGTATGCTGCATCCCTTCTCTGGTGTTGAAATTGAATTACCCCATCAAAA
TACCACCGTAGAATACAATCGTTACCGGACTGGCTTGAAGATGTACTTTTTTTACAAGGCAGTTTTGTCCTCTAGTCCTTCTCATACATC
CGACTACATTCTCGTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1549209.9e-0645 (8.1% of RFLP seq)-
SGN-U1516951.6e-0748 (8.6% of RFLP seq)-
SGN-U1549201.7e-10109 (19.6% of RFLP seq)-
SGN-U1549204.6e-1792 (16.5% of RFLP seq)-
SGN-U1516951.5e-38136 (24.5% of RFLP seq)-
SGN-U1516952.7e-49160 (28.8% of RFLP seq)-
SGN-U151694345 (62.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9557)
Chromosome
4
Position
44.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG268 was used as an overgo probe on plate 9 [well G10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P163I07,   P190K23,   P147K05,   P029A15

 Overgo Sequences

A sequence
GCTATAGGGAGATTAATCAAGTGG
B sequence
GAAGTTGTCTTGTCCGCCACTTGA
AB sequence
GCTATAGGGAGATTAATCAAGTGGCGGACA
Marker sequence
ACTTATTCAATCAAAGTGAATACTCTATAACACATTGCTATAGGGAGATT
AATCAAGTGGCGGACAAGACAACTTCTCTTAGTCACAACTACAACACCAA
CATTTTATACTCTAACAGTGGTGAACTCCCCTCCCAAATCAAAGGGCTTA
TAGCAATTGATTGTTGGAGTCTTTCGTTTATAAGAGTCTCCAACAAAAGG
AAGACAGATTTTACTTTCGACCCTCCGTGACAAATTCATAAGATCCTCCC
ATATTTGTGTATAAATGGTATTAGTCACATGGGATACCTATCTTAGGCAT
TTACCTTTTCATCTCAACTACAATAGGTACATTATCCCATATTCCACACG
GAGGGAAAAATTAGGTTGTGTGTCTGCCTCAAATCAACTGCAATGGTGTG
TTTTGGAAGATGAATAAAATTGTTTGTAAAAAAAAAAAA
Genomic location of TG268  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D589 marker 589
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)