SGN Marker CT240

SGN-M593

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT240 image not available
Forward sequence
CGTGGACTTAACAAAAAAGAAAGACCCCAAAGCCCAGGCTGTCAAGGCTGCCAAGGCTGTTAAGTCTGGATCAACCTTTAAGAAGAAGTC
AAGTAAGATAAGGACAAAAGTTACTTTCCATCGACCTAAGACATTGAAGAAGGATAGGAATCCCAAGTACCCTCGCATTAGTGCACCTGG
AAGGAACAGACTTGATCAGTACCAGGTTCTAAAATGTCCTCTTACGACCGAGTCTGCAATGAAGAAGATTGAGGACAACAATACCCTTGT
TTTCATTGTTGACATTCATGCTGACAAGAAGAAGATAAAAGATGCAGTGAAGAAAATGTATGACATCCAGATAAAGAAAGTCAATACCTT
GATCAGGCCTGATGGGACAAAGAAGGCTTATGTGAGGTTGACACCCGACTATGATGCTTTGGATGTGGCCAACAAAATTGGAATTATCTA
AATCGATTACCTAGTTTTGAATATTTCTCAGTCTTGAGTCTTTATATG
Reverse sequence
TTTTTTTTTTTTTTGAAGTTAAAATGCTTAAAATAAATATGTGAAAAGAAGCTTGCCTGACTATATGGAACAAAGTACATAGCTGAAACT
CAATATTCAAAATGAATATACCAAGGAACTTCCGTTCAAAAGTTTCCATAGAACTCATATAAAGACTCAAGACTGAGAAATATTCAAAAC
TAGGTAATCGATTTAGATAATTCCAATTTTGTTGGCCACATCCAAAGCATCATAGTCGGGTGTCAACCTCACATAAGCCTTCTTTGTCCC
ATCAGGCCTGATCAAGGTATTGACTTTCTTTATCTGGATGTCATACATTTTCTTCACTGCATCTTTTATCTTCTTCTTGTCAGCATGAAT
GTCAACAATGAAAACAAGGGTATTGTTGTCCTCAATCTTCTTCATTGCAGACTCGGTCGTAAGAGGACATTTTAGAACCTGGTACTGATC
AAGTCTGTTCCTTCCAGGTGCACTAATGCGAGGGTACTTGGGATTCCTATCCTTCTTCAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1449423.9e-1479 (15.9% of RFLP seq)+
SGN-U1680452.5e-1577 (15.5% of RFLP seq)+
SGN-U1613112.8e-2496 (19.3% of RFLP seq)+
SGN-U1613111.6e-53257 (51.6% of RFLP seq)+
SGN-U1613107.1e-62219 (44.0% of RFLP seq)+
SGN-U1449413e-104410 (82.3% of RFLP seq)+
SGN-U147707497 (99.8% of RFLP seq)+
SGN-U1449424e-1479 (15.5% of RFLP seq)-
SGN-U1680452.6e-1577 (15.1% of RFLP seq)-
SGN-U1613112.9e-2496 (18.8% of RFLP seq)-
SGN-U1613111e-51234 (45.8% of RFLP seq)-
SGN-U1613107.3e-62219 (42.9% of RFLP seq)-
SGN-U1449411.5e-81320 (62.6% of RFLP seq)-
SGN-U147707496 (97.1% of RFLP seq)-
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109252)
Chromosome
10
Position
42.93 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Eggplant-COSII   
Map version
63 (location: 42335)
Chromosome
10
Position
86.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9566)
Chromosome
10
Position
70.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9565)
Chromosome
10
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT240 was used as an overgo probe on plate 4 [well G6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAAGGATAGGAATCCCAAGTACCC
B sequence
AGGTGCACTAATGCGAGGGTACTT
AB sequence
GAAGGATAGGAATCCCAAGTACCCTCGCAT
Marker sequence
CGTGGACTTAACAAAAAAGAAAGACCCCAAAGCCCAGGCTGTCAAGGCTG
CCAAGGCTGTTAAGTCTGGATCAACCTTTAAGAAGAAGTCAAGTAAGATA
AGGACAAAAGTTACTTTCCATCGACCTAAGACATTGAAGAAGGATAGGAA
TCCCAAGTACCCTCGCATTAGTGCACCTGGAAGGAACAGACTTGATCAGT
ACCAGGTTCTAAAATGTCCTCTTACGACCGAGTCTGCAATGAAGAAGATT
GAGGACAACAATACCCTTGTTTTCATTGTTGACATTCATGCTGACAAGAA
GAAGATAAAAGATGCAGTGAAGAAAATGTATGACATCCAGATAAAGAAAG
TCAATACCTTGATCAGGCCTGATGGGACAAAGAAGGCTTATGTGAGGTTG
ACACCCGACTATGATGCTTTGGATGTGGCCAACAAAATTGGAATTATCTA
AATCGATTACCTAGTTTTGAATATTTCTCAGTCTTGAGTCTTTATATG
Genomic location of CT240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D593 marker 593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)