SGN Marker GP1049

SGN-M5938

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41581)
Chromosome
1
Position
153.10 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43549
Forward primer (5'-3')
ACCGCACCCTCCCAAATAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGGTGTTTGGATTCGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14424)
Chromosome
8
Position
119.72 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34744
Forward primer (5'-3')
Unknown
Accessions and product sizes
Capsicum frutescens BG2814-6
107
Capsicum annuum NuMex-RNaky
97
Approximate temperature
Unknown
Reverse primer (5'-3')
Unknown
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Organization: DNA Landmarks
Genomic location of GP1049  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5938 marker 5938
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)