SGN Marker CM10

SGN-M5941

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14428)
Chromosome
8
Position
122.61 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34364
Forward primer (5'-3')
TTGGTTTTTGCTACTGGTAAT
Accessions and product sizes
Capsicum annuum NuMex-RNaky
158
Capsicum frutescens BG2814-6
158
Approximate temperature
Unknown
Reverse primer (5'-3')
AAACTGTCATATATTTGTGTGACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Byung-Dong Kim
Organization: Seoul National University
Genomic location of CM10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5941 marker 5941
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)