SGN Marker TG413

SGN-M596

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCCTGCAAAAATAAAAATACAGCAAATGGGTTTTCTTCCCAAATATATAATCCCTTGGGAAAAGGAGTAGGCGATTTTTTTACCAACTG
AACAAAGTTACGTCATTGTTCAACTCTTTGTGGTTTAAGAAAATGCACAATATATAAGGTTTAAATTGTACAATCTGGGTTATTTTTCAA
A
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53305)
Chromosome
5
Position
46.15 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53304)
Chromosome
5
Position
49.40 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9577)
Chromosome
5
Position
87.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9576)
Chromosome
4
Position
2.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9578)
Chromosome
5
Position
52.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG413 was used as an overgo probe on plate 5 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTTGGGAAAAGGAGTAGGCGATT
B sequence
GTTCAGTTGGTAAAAAAATCGCCT
AB sequence
CCTTGGGAAAAGGAGTAGGCGATTTTTTTA
Marker sequence
TGCCTGCAAAAATAAAAATACAGCAAATGGGTTTTCTTCCCAAATATATA
ATCCCTTGGGAAAAGGAGTAGGCGATTTTTTTACCAACTGAACAAAGTTA
CGTCATTGTTCAACTCTTTGTGGTTTAAGAAAATGCACAATATATAAGGT
TTAAATTGTACAATCTGGGTTATTTTTCAAA
Genomic location of TG413  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D596 marker 596
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)