SGN Marker HpmshpMADS

SGN-M5973

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14466)
Chromosome
8
Position
132.31 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34371
Forward primer (5'-3')
TGCTTTCAAAACAATTTGCATGG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
210
Capsicum frutescens BG2814-6
210
Approximate temperature
Unknown
Reverse primer (5'-3')
VGCGTCTAATGCAAAACACACATTAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of HpmshpMADS  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5973 marker 5973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)