Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker Hpms1-62

SGN-M5975

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14468)
Chromosome
8
Position
133.28 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34326
Forward primer (5'-3')
CATGAGGTCTCGCATGATTTCAC
Accessions and product sizes
Capsicum frutescens BG2814-6
186
Capsicum annuum NuMex-RNaky
186
Approximate temperature
Unknown
Reverse primer (5'-3')
GGAGAAGGACCATGTACTGCAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-62  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5975 marker 5975
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)